Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Site-directed labelled ubiquitin-specific protease 7 and preparation method and application thereof

A specific, protease-based technology, applied in botanical equipment and methods, biochemical equipment and methods, applications, etc., can solve the problem of non-expression of ubiquitin-specific protease 7, difficulty in protein fixed-point labeling, ubiquitin-specific protease 7 Problems such as low expression level, to achieve the effects of small impact on structure and activity, broad application prospects and market value, and simple operation

Pending Publication Date: 2019-07-02
SHENZHEN INST OF ADVANCED TECH
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At the same time, ubiquitin-specific protease 7 has the problem of no expression or low expression, which causes great difficulties in the site-specific labeling of the protein. Therefore, a method that can solve the problem of low expression of ubiquitin-specific protease 7 and complete its The fixed-point marking method has great scientific research value and application prospects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Site-directed labelled ubiquitin-specific protease 7 and preparation method and application thereof
  • Site-directed labelled ubiquitin-specific protease 7 and preparation method and application thereof
  • Site-directed labelled ubiquitin-specific protease 7 and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] (1) Perform site-directed mutagenesis on protease 7 by designing primers, introduce a histidine tag at the C-terminus for purification, introduce a Strep tag at the N-terminus, and introduce NdeI and XhoI restriction sites at the 5' and 3' ends, respectively, The fragment with the mutation site was obtained by PCR, and then overlap PCR was performed to obtain the complete ubiquitin-specific protease 7 mutant sequence. The structure diagram of ubiquitin-specific protease 7 is shown in figure 1 shown;

[0049] a) The PCR reaction system is as follows:

[0050]

[0051] The nucleic acid sequence of the forward primer F1 is shown in SEQ ID NO:1;

[0052] SEQ ID NO:1AGTCCATATGAACCACCAGCAGCAGCAG; the nucleic acid sequence of the reverse primer R1 is shown in SEQ ID NO:3:

[0053] SEQ ID NO: 3AGTCCTCGAGGTTATGGATTTTAATGGCC; the above PCR system obtained the WT USP7-his fragment.

[0054] b) The PCR reaction system is as follows:

[0055]

[0056] The nucleic acid sequ...

Embodiment 2

[0092] Compared with Example 1, other conditions are the same as Example 1 except that the selected labeling group is azido group.

Embodiment 3

[0094] Compared with Example 1, except that the selected unnatural amino acid is azidoalanine, other conditions are the same as Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a site-directed labelled ubiquitin-specific protease 7 and a preparation method and an application thereof. After site-directed mutation, the ubiquitin-specific protease 7 is subjected to site-directed labelling by non-natural amino acids with labelled groups, wherein the non-natural amino acids with the labelled groups are introduced by a tRNA synthetase / tRNA pair. The protein expression flow is optimized, and specific labels and expression vectors are selected; the non-natural amino acids are introduced through the tRNA synthetase and the tRNA pair. All the steps andthe conditions are in synergistic interaction, the protein expression quantity is improved and site-directed labelling is completed, and the preparation method is simple to operate and easy to promote, does not affect the structure and activity of the protease 7and has broad application prospects and great market value.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a point-directed labeling ubiquitin-specific protease 7 and its preparation method and application. Background technique [0002] Ubiquitin widely exists in eukaryotes and plays an important role in cell physiological and biochemical processes. Under the catalysis of ubiquitin enzymes at all levels, ubiquitin molecules can perform specific post-translational modifications on target proteins called ubiquitination. Ubiquitination is an important pathway of protein post-translational modification, through 2 to 4 cascades of enzymes that specifically modify the stability, localization and activity of target proteins. In contrast, ubiquitination can be reversed by deubiquitinating enzymes, termed deubiquitination, that antagonize ubiquitination by cleaving mono- and polyubiquitin, thereby providing an additional level of post-translational regulation. Deubiquitinase can specifically hyd...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/50C12N15/57C12N15/70
CPCC12N9/50C12N15/70
Inventor 金宗文杨偲袁静罗擎颖刘琳
Owner SHENZHEN INST OF ADVANCED TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com