Site-directed labelled ubiquitin-specific protease 7 and preparation method and application thereof
A specific, protease-based technology, applied in botanical equipment and methods, biochemical equipment and methods, applications, etc., can solve the problem of non-expression of ubiquitin-specific protease 7, difficulty in protein fixed-point labeling, ubiquitin-specific protease 7 Problems such as low expression level, to achieve the effects of small impact on structure and activity, broad application prospects and market value, and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] (1) Perform site-directed mutagenesis on protease 7 by designing primers, introduce a histidine tag at the C-terminus for purification, introduce a Strep tag at the N-terminus, and introduce NdeI and XhoI restriction sites at the 5' and 3' ends, respectively, The fragment with the mutation site was obtained by PCR, and then overlap PCR was performed to obtain the complete ubiquitin-specific protease 7 mutant sequence. The structure diagram of ubiquitin-specific protease 7 is shown in figure 1 shown;
[0049] a) The PCR reaction system is as follows:
[0050]
[0051] The nucleic acid sequence of the forward primer F1 is shown in SEQ ID NO:1;
[0052] SEQ ID NO:1AGTCCATATGAACCACCAGCAGCAGCAG; the nucleic acid sequence of the reverse primer R1 is shown in SEQ ID NO:3:
[0053] SEQ ID NO: 3AGTCCTCGAGGTTATGGATTTTAATGGCC; the above PCR system obtained the WT USP7-his fragment.
[0054] b) The PCR reaction system is as follows:
[0055]
[0056] The nucleic acid sequ...
Embodiment 2
[0092] Compared with Example 1, other conditions are the same as Example 1 except that the selected labeling group is azido group.
Embodiment 3
[0094] Compared with Example 1, except that the selected unnatural amino acid is azidoalanine, other conditions are the same as Example 1.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com