Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction and application of binary expression vector

A binary expression carrier and construction method technology, applied in the construction and application field of binary expression carrier, can solve the problem of excessive heavy metal inhalation by the human body, achieve the effect of reducing the content of heavy metal cadmium, avoiding the accumulation of heavy metals, and reducing the accumulation of cadmium

Inactive Publication Date: 2019-04-19
QINGDAO YUANCE GRP CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0016] The technical problem to be solved by the present invention is to overcome the deficiencies and defects in the prior art, and provide a construction and application of a binary expression vector, which can effectively reduce the accumulation of cadmium in rice grains, so as to solve the problem of excessive accumulation of cadmium in existing rice grains And the technical problems that cause the human body to inhale excessive heavy metals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of binary expression vector
  • Construction and application of binary expression vector
  • Construction and application of binary expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1: Construction of binary expression vector

[0059] 1. Obtaining the DNA fragment of the promoter EXP B:

[0060] Specifically, the following steps are included:

[0061] Step 1, according to the known rice root-specific expression promoter nucleotide sequence, design specific amplification primers, the primer sequence is as follows:

[0062] EXP B-F: GAATTCTTTATTTTATTCATTTATTCAC (SEQ ID NO. 3)

[0063] EXP B-R: GAGCTCCCTGCGTACACGGCCACATGAA (SEQ ID NO. 4)

[0064] Step ②, extracting rice genomic DNA:

[0065] In this example, rice leaves were used as materials to extract genomic DNA. It can be understood that there are many varieties of rice, and those skilled in the art can use different varieties of rice to extract rice genomic DNA according to the actual situation. In the scheme of this application, the specific use of tobacco of that variety is not limited to obtain the DNA of the promoter EXP B fragment. In addition, there are many DNA extraction met...

Embodiment 2

[0106] Embodiment two: the acquisition of rice transgenic positive plants

[0107] 1. Transfer the binary expression vector pCAMBIA1300-EXP B-OsHAM3 obtained in step 3 into Agrobacterium.

[0108] 2. The agrobacterium containing the binary expression vector pCAMBIA1300-EXP B-OsHAM3 prepared in the above 1 was used to infect the callus of rice Nipponbare, and after 2 days of co-cultivation, T0 transgenic plants.

[0109] Specifically, the following steps are included:

[0110] ① Pick a single colony and inoculate it into 25 mL of freshly prepared Agrobacterium culture medium (with antibiotics added), shake culture at 250-300 rpm overnight at 28°C, expand the Agrobacterium to 0.3<OD550<1.0, and centrifuge the bacterial solution at 6000g for 5 minutes ( 4°C), gently resuspend Agrobacterium until OD550=0.1 (add 100 μMAS, the concentration of AS dissolved in DMSO mother solution is 100 mmol / L);

[0111] ② Infect the pre-cultured callus for 5-10 minutes, gently flip or shake the ...

Embodiment 3

[0126] Example 3: Verification of the uptake and accumulation of Cd in rice grains with the binary expression vector pCAMBIA1300-EXP B-OsHAM3, the specific implementation process is as follows:

[0127] ① Plant the T2 generation transgenic material of the rice with the binary expression vector pCAMBIA1300-EXP B-OsHAM3 and the wild-type rice separately in the same growth environment;

[0128] ② Rice plants were irrigated with 0.1 μM cadmium rice during the whole growth period;

[0129] ③When the rice is mature, collect the rice grains, roots and shoots respectively, and dry the collected rice grains, roots and shoots in an oven at 60°C for 3 days to obtain dry samples;

[0130] ④Weigh about 0.25g of dry sample into a digestion tube, add 5ml of mixed acid (volume ratio HNO3:HClO4=85:15) for digestion;

[0131] ⑤ Dilute the sample digestion solution to 25ml with a concentration of 2% HNO3, shake well and filter with a 0.45μm filter;

[0132] ⑥ The Cd content in each sample was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a binary expression vector. The method comprises the steps of (1) obtaining a promoter DNA fragment; (2) obtaining a coding DNA fragment; (3) transferring the promoter DNA fragment obtained in step 1 and the coding DNA fragment obtained in step 2 into a vector plasmid to obtain the expression vector. In the method for constructing the binary expression vector, a promoter EXP B has the property of specifically inducing downstream gene expression in rice roots, and through the promoter EXP B in the binary expression vector, a nucleotide sequencein the binary expression vector encoding OsHMA3 are overexpressed in the rice roots.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering of modern molecular biology, and more specifically relates to the construction and application of a binary expression vector. Background technique [0002] Generally, plant expression vectors are used in a set, and there are two in a set, one is a common vector with a fusion protein (usually GFP or Gus) that can be inserted into an MCS of an exogenously expressed gene and a screening tag. [0003] Another vector is the binary vector (binary-vector). Usually, the exogenous gene is inserted into a vector with a screening marker first, and then all the 35S promoter-expression gene-gfp section on the vector is cut out, and then a subcloning is constructed. The process is to insert the above fragment into a binary vector Between the LB and RB, the insertion direction can be arbitrary. [0004] Then transform the binary vector with 35S promoter-expression gene-gfp into Agrobacterium,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/55C12N15/11A01H5/10A01H6/46
CPCC12N9/14C12N15/8227C12N15/8243C12Y306/01003
Inventor 张国栋刘佳音米铁柱吴洁芳李继明万吉丽
Owner QINGDAO YUANCE GRP CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com