FnCpf1 mediated in-vitro DNA editing kit
A kit and cpf1 technology, applied in the field of molecular biology, can solve the problems of complicated and time-consuming operation, limited flexible application, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] Example 1 DNA connection method based on CRISPR / Cpf1 system
[0082] One, the test kit and method of iCOPA of the present invention
[0083] 1. Add sample
[0084]
[0085] Among them, the carrier and the linearized insert have a CrRNA recognition cutting region that guides the Cpf1 enzyme, and the CrRNA recognition cutting region is formed by connecting a PAM site and a spacer with a length of 23 bp;
[0086] CrRNA template DNA: composed of T7 promoter, DR, spacer sequence;
[0087] DR is 19 or 36nt, and the spacer sequence length is 23nt;
[0088] T7 promoter sequence: GAAATTAATACGACTCACTATAGG;
[0089] 19nt DR sequence: AATTTCTACTGTTGTAGAT;
[0090] 36nt DR sequence: GTCTAAGAACTTTAAATAATTTCTACTGTTGTAGAT;
[0091] The number of CrRNA template DNA is more than 1, and the spacer sequence is consistent with the 23nt length recognition region on the vector and the insert fragment respectively.
[0092] The transcription mixture (available from Tiangen Company) co...
Embodiment 2
[0133] Example 2 Screening experiment of the DNA connection method based on the CRISPR / Cpf1 system of the present invention
[0134] 1. Optimizing the conditions for in vitro shearing of Cpf1
[0135] Wild-type FnCpf1 tends to cleave TTV PAM more than TTT). In order to obtain a suitable balance of reaction conditions corresponding to PAMTTN, to facilitate the universality and efficiency of subsequent toolbox experiment design. We first selected two groups of spacers (E-SP3: TTT PAM; E-SP15: TTA PAM) for in vitro enzyme activity testing. Linearized DNA T PAM 1 and T Red 1 were used as digestion substrates corresponding to spacer E-SP3 and spacer E-SP15, respectively. The sheared product fragments are 527bp and 707bp or 802bp and 2233bp, respectively.
[0136] According to the aforementioned system, perform the following screening to determine the parameters of the CRISPR / Cpf1 system:
[0137] 1. Test the effect of crRNA concentration on shearing efficiency, including 10nM...
experiment example 1
[0141] Experimental Example 1 Editing using the kit of the present invention: inserting fragments based on FnCpf1
[0142] The purpose of the experiment: add the promoter plac before the fluorescent protein expression gene mRFP, thereby activating the expression of the fluorescent protein mRFP;
[0143] 1. Select the spacer on the original vector, and design the corresponding spacer that can be applied to the promoter
[0144] (Table 1-1)
[0145] Table 1-1 The spacer applied to mRFP fluorescent protein activation
[0146]
[0147] 2. Obtain crRNA by PCR to prepare substrate template DNA
[0148] According to the requirements of the T7 transcription kit, design the corresponding primers (Table 1-2)
[0149] Table 1-2 is used to prepare substrate template DNA for crRNA activated by mRFP
[0150]
[0151] The obtained primers were used for PCR enrichment, and the enzyme used was Q5 high-fidelity enzyme (NEB Company, product number M0491). The specific configuration sy...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com