Preparation method and application of humanized CD40 gene remolding animal model
An animal model, humanized technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, plant genetic improvement, etc., can solve the genetic instability of transgenes, the uncertainty of insertion copy number, and the low accuracy. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0200] Example 1 Design of Cd40 gene sgRNA
[0201] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.
[0202] Design and synthesize sgRNA sequences that recognize the 5' target site (sgRNA1-sgRNA7) and the 3' target site (sgRNA8-sgRNA14). The 5' target site is located on exon 2 of the Cd40 gene, and the 3' target site is located on exon 7 of the Cd40 gene. The target site sequences of each sgRNA on Cd40 are as follows:
[0203] sgRNA-1 target site sequence (SEQ ID NO: 1): 5'-GACAAACAGTACCTCCACGATGG-3'
[0204]sgRNA-2 target site sequence (SEQ ID NO: 2): 5'-CGGGACAGCTTGGGGTATTCTGG-3'
[0205] sgRNA-3 target site sequence (SEQ ID NO: 3): 5'-ACGTAACACACTGCCCTAGATGG-3'
[0206] sgRNA-4 target site sequence (SEQ ID NO: 4): 5'-GGGTCTTGGTACGGGGCAGGAGG-3'
[0207]...
Embodiment 2
[0217] Example 2 Screening of sgRNA
[0218] UCA kit was used to detect the activities of multiple sgRNAs. The results showed that the sgRNAs had different activities. For the test results, see figure 1 and Table 1. Two of them were selected (sgRNA1 and sgRNA8 respectively) and the upstream and downstream single strands of the sgRNA were synthesized for subsequent experiments. The upstream and downstream single-strand sequences of sgRNA1 and sgRNA8 are as follows:
[0219] sgRNA1 sequence:
[0220] Upstream: 5'-acaaacagtacctccacga-3' (SEQ ID NO: 15)
[0221] Downstream: 5'-tcgtggaggtactgtttgt-3' (SEQ ID NO: 16)
[0222] sgRNA8 sequence:
[0223] Upstream: 5'-catccgggactttaaacc-3' (SEQ ID NO: 17)
[0224] Downstream: 5'-ggtttaaagtcccggatg-3' (SEQ ID NO: 18)
[0225] Table 1 sgRNA activity detection results
[0226]
Embodiment 3
[0227] Example 3 pT7-sgRNA G2 plasmid construction
[0228] Source of pT7-sgRNA G2 plasmid: pT7-sgRNA G2 vector map, see figure 2 . The plasmid backbone is from Takara, Cat. No. 3299.
[0229] The fragment DNA (SEQ ID NO: 19) containing the T7 promoter and sgRNA scaffold was synthesized by a plasmid synthesis company and ligated to the backbone vector by restriction enzyme digestion (EcoRI and BamHI). It was verified by sequencing by a professional sequencing company, and the results showed that the target plasmid was obtained.
[0230] Fragment DNA containing T7 promoter and sgRNA scaffold (SEQ ID NO: 19):
[0231] gaattctaatacgactcactataggggtcttcgagaagacctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttaaaggatcc
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com