Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tobacco nicotine content regulation gene TIFY6B as well as cloning method and application thereof

A technique of regulating genes and cloning methods, which is applied in the field of genetic engineering, can solve problems affecting nicotine content, etc., and achieve the effect of huge economic benefit potential and broad application prospects

Inactive Publication Date: 2018-12-28
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Regulating nicotine synthesis genes through chloride channels to affect nicotine content has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco nicotine content regulation gene TIFY6B as well as cloning method and application thereof
  • Tobacco nicotine content regulation gene TIFY6B as well as cloning method and application thereof
  • Tobacco nicotine content regulation gene TIFY6B as well as cloning method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] clone TIFY6B Gene

[0050] Tobacco leaf cDNA was used as a template, and primers were designed according to the tobacco genome database information, and the TIFY 6B PCR amplification of the gene to obtain the PCR amplification product. Design primers as follows:

[0051] Forward primer: 5'- ATGGAGAGAGATTTTATGGGTTTGAC -3'

[0052] Reverse primer: 5'-TCACCTTGTGTCTACATTATTTTGCC-3'.

[0053] The PCR reaction system and amplification conditions are shown in Table 1.

[0054] Table 1 PCR reaction system and conditions

[0055]

[0056] The amplified PCR product was electrophoresed on a 0.8% agarose gel, and the gel electrophoresis results were as follows: figure 1 shown. After electrophoresis, the PCR product purification kit from Qiagen was used to recover and purify the PCR product according to the product instructions, and sent to Invitrogen for sequencing to verify the sequence results.

Embodiment 2

[0058] Construction of Plant RNAi Vectors

[0059] In Example 1 TIFY 6B The full-length fragment is used as a template, and the primers containing the gateway adapter sequence are used for PCR amplification. After the PCR product is purified, the amplified product is inserted into the pdonr-zeo vector of Invitrogen Company through BP reaction ( figure 2 )middle. The constructed BP reaction carrier will be converted to TIFY 6B Fragment replacement into pHellsgate12 RNAi interference vector ( image 3 )middle.

[0060] (1) The gateway reaction primer sequence is as follows:

[0061] TIFY 6B _F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCTCAAGCTATTATGTTGCTTGCTGGAAATG-3';

[0062] TIFY 6B _R: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGAAGGAGATGGTAGGACCCCAATTG-3'.

[0063] (2) PCR reactions were performed using Phusion high-fidelity polymerase for PCR cloning.

[0064] (3) The PCR reaction system and conditions are the same as in Example 1.

[0065] (4) BP response:

[0066] (a) ...

Embodiment 3

[0081] Agrobacterium-mediated transformation of tobacco and identification of transgenic plants

[0082] (1) Transformation of Agrobacterium by freeze-thaw method

[0083] Add 1 μg (200 ng / μL) pHellsgate12 recombinant vector to 100 μL competent Agrobacterium LBA4404, mix well, let stand on ice for 5 min, freeze in liquid nitrogen for 5 min, and then take it out from the liquid nitrogen. Place in a water bath at 37°C for 5 minutes, then let stand on ice for 5 minutes, add 500 μL LB solution, resume cultivation at 28°C for 4 hours under sufficient shaking conditions, and finally spread the bacterial solution evenly on the selective plate culture medium at 28°C for 48 h.

[0084] (2) Tobacco variety K326 was transformed by leaf disk method.

[0085] The specific method is as follows:

[0086] (a) Under aseptic conditions, put the tobacco K326 seeds into the EP tube and wash them with sterile water for 2-3 times;

[0087] (b) Soak in 75% alcohol for 30-60 s;

[0088] (c) Trea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tobacco nicotine content regulation gene TIFY6B as well as a cloning method and application thereof. The nucleotide sequence of the tobacco nicotine content regulation gene TIFY6B is shown as SEQ ID NO:1; the amino acid sequence of the encoded protein is shown as SEQ ID NO:2. The cloning method comprises the following steps: synthesizing tobacco leaf cDNA, namely extracting tobacco leaf total RNA, and performing reverse transcription to obtain a first chain cDNA; performing PCR amplification on the gene TIF6B, namely taking the tobacco leaf cDNA as a template, designing a primer according to the sequence of the gene TIFY6B, performing PCR amplification, recovering and purifying the PCR amplification product, and sequencing. The invention further discloses application of the tobacco nicotine content regulation gene TIFY6B in an aspect of obtaining high-nicotine content transgenic tobacco plants. The expression of the gene TIFY6B is inhibited in the tobacco plant, the content of nicotine in tobacco leaves can be obviously improved, and the gene TIFY6B has wide application prospects in actual production.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a tobacco nicotine content regulating gene TIFY6B and its cloning method and application. Background technique [0002] It is very meaningful to study the metabolic regulation of tobacco nicotine. Through gene regulation, tobacco varieties with different nicotine content can be provided, which can provide raw materials for the commercial production of personalized nicotine tobacco products. Nicotine has a strong physiological stimulating effect on the human body and is the material basis for the commercial use of tobacco. Many of the world's top tobacco companies such as Philip Morris, Imperial Tobacco, Japan Tobacco, British American Tobacco and other companies have invested heavily in research on the metabolic pathways and regulatory mechanisms of tobacco nicotine. [0003] Nicotine is a pyridine alkaloid, mainly found in Solanaceae Nicotiana ( Nicotia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/10C12N15/82A01H5/00A01H6/82
CPCC07K14/415C12N15/1096C12N15/8218C12N15/8243C12Q2531/113
Inventor 逄涛白戈谢贺李勇杨大海姚恒张谊寒肖炳光李永平
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com