Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Black and ageing specific inducing promoter, engineering vector and application

A promoter and dark technology, applied in the field of genetic engineering, can solve problems such as premature leaf senescence and shedding, abiotic stress, such as pests and diseases, long-term low light/darkness, drought, abnormal temperature, affecting crop yield and quality, etc., to achieve inhibition effects of aging

Active Publication Date: 2018-12-07
TOBACCO RES INST CHIN AGRI SCI ACAD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Senescence is the last stage of plant leaf development. During this process, a series of physiological and biochemical reactions will occur, including chlorophyll degradation, cell structure collapse, and nutrient reuse. Plants will face biological or abiotic factors from the environment during their growth. Stress, such as pests and diseases, long-term low light / darkness, drought, abnormal temperature, etc., after plants suffer from these stresses, they will accelerate the aging process of leaves, and nutrients will be redistributed from aging tissues to fruits or young organs, which will enhance the growth rate of leaves to a certain extent. Plant adaptability, therefore, leaf senescence has positive significance for plants; however, abnormal leaf senescence (premature senescence or late senescence) affects crop yield and quality; premature senescence prevents plants from fully completing photosynthesis, and organic matter accumulates and harvests It may cause crop yield reduction and quality degradation; understanding and realizing the artificially controllable leaf senescence process is of great significance in agricultural production;
[0003] Leaf senescence is the result of a combination of internal and external factors, among which weak light or darkness can accelerate the process of leaf senescence, which is also one of the important influencing factors; studies have shown that in the process of plant senescence affected by light, the photoreceptor phyB - The PIF pathway is involved, and plant hormones such as jasmonic acid are also involved in the leaf senescence process induced by low light / darkness; in actual agricultural production, the spacing between plants or rows is small, and the leaves of crops block each other, which is prone to shade avoidance effects , premature senescence and shedding of leaves, affecting yield and quality

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Black and ageing specific inducing promoter, engineering vector and application
  • Black and ageing specific inducing promoter, engineering vector and application
  • Black and ageing specific inducing promoter, engineering vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] A dark and aging-specific inducible promoter, the promoter is shown in the nucleotide sequence of SEQ ID NO:1.

[0039]The promoter contains a 5'UTR sequence, which is located at position 333-461 of the sequence. In subsequent promoter applications, in order to ensure the driving effect of the SLC1 promoter, this 5'UTR sequence is included in the construction of the engineering vector

[0040] The promoter has eukaryotic promoter core elements TATA-box and CAAT-box, which are respectively located at positions 300-303 and positions 326-329 of the sequence.

[0041] The preparation process of the promoter is as follows: extract wild-type Arabidopsis col genomic DNA, and use SLC1 promoter-specific primers (proSLC1F:GAATTTAATCAAACACCTTCT; proSLC1R:CACGCTAGTACCCAAAAC) for PCR amplification; amplification procedure: step1: 95°C for 3 minutes; step2: 95 30s at ℃, 30s at 57℃, 30s at 72℃, 32 cycles; step3: 10min at 72℃. After the reaction, the PCR fragment was recovered and co...

Embodiment 2

[0043] qRT-PCR identification of SLC1 promoter induced by darkness and senescence:

[0044] In order to clarify the expression characteristics of the SLC1 promoter, the applicant used qRT-PCR technology to detect the expression of the SLC1 gene at the transcriptional level. In the experiment, the sixth rosette leaf of the wild-type Arabidopsis col grown for 28 days was darkened for 12 hours For treatment, the materials were taken at 0, 3, 6, and 12 hours respectively, and RNA was extracted, reverse-transcribed into cDNA, and used as a template, using primers: SLC1-qRTF:CACTCAAAGTGTGTGGAGGA, SLC1-qRTR:CTGTCGCCGGCGTTAATGGAG for qRT-PCR analysis; The results show that if figure 1 As shown, the transcription level of SLC1 gene can be induced by darkness, indicating that the SLC1 promoter has the characteristic of being induced by darkness; in addition, we detected the change of transcription level of SLC1 with the process of leaf senescence, and extracted and grown 14 days, 28 day...

Embodiment 3

[0046] Histochemical staining (GUS staining) and luciferase method (LUC) identified that the SLC1 promoter can be induced by darkness and aging:

[0047] (1) Histochemical staining (GUS): Design specific primers (proSLC1-GUSF: GCAGGCATGCAAGCTTGAATTTAATCAAACACCTTCT; proSLC1-GUSR: CTCAGATCTACCATGGCACGCTAGTACCCCAAAACA) for cloning the SLC1 promoter with linkers, and extract wild-type col Arabidopsis genomic DNA as The template was amplified, the amplification program: step1: 95°C for 3min; step2: 95°C for 30s, 56°C for 30s, 72°C for 30s, 32 cycles; step3: 72°C for 10min.

[0048] After the amplified product was recovered and purified, it was ligated into the pCAMBIA3301-GUS vector using infusion recombination technology. The method and system were: 2 μL of SLC1 promoter fragment, 2 μL of pCAMBIA3301-GUS (after double digestion with HindIII and NcoI), 1 μL of infusion enzyme; 50°C After reacting for 15 minutes, the ligation product was transformed into Escherichia coli DH5a, and t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering and relates to a black and ageing specific inducing promoter, an engineering vector and an application. The promoter is shown as a nucleotide sequence of SEQ ID NO:1. The engineering vector has a promoter sequence with the nucleotide sequence of SEQ ID NO:2. The invention establishes an SLC1 promoter for driving an IPT1 gene expression vector, so that the specific high expression of the IPT1 gene under a dark condition and in a leaf ageing period can be realized, the acceleration of the ageing process of the leaves under the dark condition can be restrained, and meanwhile, the ageing process of plants caused by age can be restrained, namely, the accelerated ageing process of leaves is restrained under a dark condition while the plant can delay ageing under normal conditions. The black and ageing specific inducing promoter and the engineering vector can be widely applied to the application research on the relevant theory of restraining plant IPT1 gene expression, darkness resistance of plants, ageing resistance, and the like.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a promoter and an engineering carrier with inducible characteristics related to plant leaves, in particular to a dark and senescence-specific inducible promoter, an engineering carrier and applications. Background technique [0002] Senescence is the last stage of plant leaf development. During this process, a series of physiological and biochemical reactions will occur, including chlorophyll degradation, cell structure collapse, and nutrient reuse. Plants will face biological or abiotic factors from the environment during their growth. Stress, such as pests and diseases, long-term low light / darkness, drought, abnormal temperature, etc., after plants suffer from these stresses, they will accelerate the aging process of leaves, and nutrients will be redistributed from aging tissues to fruits or young organs, which will enhance the growth rate of leaves to a certain extent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/12A01H6/20
CPCC07K14/415C12N15/8266
Inventor 张增林郭永峰李伟高晓明徐萌萌
Owner TOBACCO RES INST CHIN AGRI SCI ACAD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products