Method for improving cellulose utilization ratio by using glycosyl transferase promoter to drive GA20ox
A glycosyltransferase and promoter technology, applied in the field of genetic engineering, to achieve the effects of increased S/G ratio, more biomass, great research value and application potential
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] In order to further illustrate the method for utilizing the glycosyltransferase 8D1 promoter of the present invention to drive GA20ox to improve lignocellulose utilization, the specific method and data description of 8D1P:GA20ox transgenic 84K poplar by genetic engineering are as follows:
[0065] The drugs involved in the test in Example 1 were all purchased from Sigma Company, Fermentas Company, ThermoFisher Company, and Shanghai Sangong Company.
[0066] Molecular Cloning of GA20ox Gene
[0067] 1. Extract the stem of Arabidopsis thaliana to extract its total RNA, use RT-PCR technology to amplify the full-length cDNA of GA20ox gene, and sequence it. See SEQ ID No.1 for the sequence. Amplification conditions were: 95°C for 5min pre-denaturation; 94°C for 30s, 55°C for 40s, 72°C for 1min, completing 35 cycles; and 72°C for 8min for fragment extension. The amplification primers are:
[0068] ArGA2OF:TGCAGGATCCATGGCCGTAAGTTTCGTAAC
[0069] ArGA2OR:TGCAGAGCTCTTAGATGGGT...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com