Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice mapk6 gene mutant and its application

A technology for rice and rice grains, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problem of not knowing whether the grains are getting bigger or smaller.

Active Publication Date: 2020-07-07
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, those skilled in the art still have no way of knowing which mutations in the OsMAPK6 gene can affect the size of the grain.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice mapk6 gene mutant and its application
  • Rice mapk6 gene mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Obtaining of DN-OsMAPK6 Encoding Gene and CA-OsMAPK6 Encoding Gene

[0028] 1. Extract RNA

[0029] The leaves of rice Zhonghua 11 were crushed with liquid nitrogen, and the total RNA was extracted with the Plant Total RNA Extraction Kit (TIANGEN). The obtained total RNA was detected by a spectrophotometer (Eppendorf, Germany) to detect the concentration of total RNA in the sample.

[0030] 2. Acquisition of DN-OsMAPK6 coding gene

[0031] According to the OsMAPK6 gene sequence on RAP-DB (http: / / rapdb.dna.affrc.go.jp / ), two pairs of primers were designed as follows:

[0032] OsMAPK6-F1: GGCTGCAGGAATTCAAGCTTATGGACGCCGGGGCGCAGC

[0033] OsMAPK6-R2: CAGATCAGTATCCATCAATTCACATGCAATATAAACGTCATTGA

[0034] DN-OsMAPK6-F: GCTGAGTTTGTTGTCACAAGATGGTAT

[0035] DN-OsMAPK6-R:CCATCTTGTGACAACAAACTCAGCCATAAAATCGGTTTCTGAGGT

[0036] Take 5 μg of total RNA, reverse transcription with a reverse transcription kit (Invitrogen), use the cDNA obtained by reverse transcription ...

Embodiment 2

[0046] Example 2 Construction of DN-OsMAPK6 and CA-OsMAPK6 expression vectors

[0047] Using the seamless cloning kit (TIANGEN), the fragment A and fragment B recovered in Example 1 were seamlessly cloned with pIPKB003 at the same time, and the ligated product was transformed into Escherichia coli DH5α competent cells, according to the spectinomycin resistance marker on the carrier Positive clones were screened to obtain a recombinant plasmid containing the fusion of A and B fragments, which was named pIPKB003-DN-OsMAPK6.

[0048] Using the seamless cloning kit (TIANGEN), the fragments C and D recovered in Example 1 were seamlessly cloned with pIPKB003 at the same time, and the ligated product was transformed into Escherichia coli DH5α competent cells, and screened according to the spectinomycin resistance marker on the carrier Positive clones obtained a recombinant plasmid containing the fusion of C and D fragments, named pIPKB003-CA-OsMAPK6.

[0049] Introduce pIPKB003-DN-O...

Embodiment 3

[0051] The acquisition of embodiment 3 transgenic plants

[0052] The rice variety Zhonghua 11 was transformed with GV3101-DN-OsMAPK6 and GV3101-CA-OsMAPK6 to obtain transgenic plants transgenic for DN-OsMAPK6 and CA-OsMAPK6, respectively. The specific operation is as follows:

[0053] 1. Induction culture of rice mature embryo callus: the shelled mature rice seeds are first soaked in 70% ethanol for 1-2 minutes, then soaked in 0.1% mercury chloride for 10 minutes, sterilized on the surface, and rinsed with sterile water for 3-4 times , and then put the seeds on sterile filter paper to absorb water, put them on mature embryo callus induction medium, and cultivate them in the dark at 26°C. After about 10-15 days, the callus grown from the mature embryo scutellum was peeled off, transferred to the mature embryo subculture medium, and subcultured under the same conditions. Subculture every two weeks thereafter. Select subcultured 5-7 days callus with light yellow color for co-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides rice MAPK6 gene mutants and application thereof, and belongs to the technical field of plant genetic engineering. The rice MAPK6 gene mutants provided by the invention are respectively DN-OsMAPK6 and CA-OsMAPK6, and the nucleotide sequences thereof are shown in SEQ ID NO. 2 and SEQ ID NO. 4. The invention proves that the mutant DN-OsMAPK6 has a function of making rice grainssmaller after being transferred into rice, the mutant CA-OsMAPK6 has a function of making rice grains larger after being transferred into rice, and therefore the mutants play an important role in genetic improvement breeding of rice germplasm resources. The invention also provides application of the mutants in rice breeding and seed production.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to rice MAPK6 gene mutant MAPK6 and its application in affecting rice grain size. Background technique [0002] Rice (Oryza sativa L.) is one of the three most important food crops in my country and the world, the staple food of more than half of the world's population, and an important model plant for functional gene research. With the reduction of arable land and the rapid growth of population, it is of great significance to increase rice production to ensure food security in our country. The current research on increasing rice yield is more dependent on limited rice germplasm resources, the advantages of traditional hybrid breeding are gradually weakening, and rice transgenic technology may explore the potential of further increasing rice yield. [0003] In the plant kingdom, plants that can form seeds account for more than two-thirds of the total number of p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/10A01H6/46
CPCC07K14/415C12N15/8261
Inventor 徐冉段朋根于海跃李云海
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More