Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of zfpm2-as1 in preparation of gastric cancer diagnostic reagent or kit

A ZFPM2-AS1, diagnostic kit technology, applied in the field of medical biological detection, can solve the problem of less ZFPM2-AS1, and achieve the effect of improving the detection rate and accuracy, high repeatability, and high clinical reference value

Active Publication Date: 2021-09-07
SHANGHAI CHANGHAI HOSPITAL
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are very few studies on ZFPM2-AS1
There is no literature report on the application of ZFPM2-AS1 in the diagnosis of gastric cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of zfpm2-as1 in preparation of gastric cancer diagnostic reagent or kit
  • Application of zfpm2-as1 in preparation of gastric cancer diagnostic reagent or kit
  • Application of zfpm2-as1 in preparation of gastric cancer diagnostic reagent or kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Detection of the expression level of ZFPM2-AS1 in gastric cancer and non-cancerous tissues

[0041] 1. Sample collection

[0042] Seventy-three pairs of gastric cancer and paracancerous tissue samples were collected and placed in a -80°C refrigerator. All cases did not receive radiotherapy and chemotherapy before surgery, all patients signed an informed consent, and the experimental protocol was approved by the ethics committee of the unit.

[0043] 2. Total RNA extraction

[0044]1) Take out clinical specimens from the -80°C refrigerator and place them on ice. Weigh 25mg of tissue and place it in a 2ml centrifuge tube, place it on ice, add 1ml Trizol to the centrifuge tube, use a hand-held automatic tissue homogenizer to process until there is no solid component, and let it stand at room temperature for 10 minutes.

[0045] 2) Centrifuge at 13000 rpm for 10 min at 4°C.

[0046] 3) Pipette the supernatant into a clean RNase-Free 1.5mL centrifuge tube.

[...

Embodiment 2

[0075] Example 2 Expression of ZFPM2-AS1 in gastric cancer cells

[0076] 1. Cell culture

[0077] Human immortalized gastric mucosal epithelial cells GES-1, human gastric cancer cell lines AGS, BCG-823, MGC-803, MKN-28, MKN-45 and SGC-7901 were all cultured in DMEM with 10% fetal bovine serum at 37°C, 5%CO 2 cultured in an incubator.

[0078] 2. RNA extraction

[0079] Discard the medium, wash with PBS twice, add appropriate amount of Trizol, and pipette repeatedly to accelerate cell lysis. All the other steps are the same as in Example 1.

[0080] 3. RT-qPCR

[0081] Concrete steps are with embodiment 1.

[0082] 4. Results

[0083] The result is as figure 2 As shown, compared with gastric mucosal epithelial cells, the expression level of ZFPM2-AS1 in gastric cancer cell lines was significantly up-regulated, and the difference was statistically significant ((all P<0.05).

Embodiment 3

[0084] Example 3 Expression inhibition of ZFPM2-AS1

[0085] 1. Cell culture

[0086] Concrete steps are with embodiment 2.

[0087] 2. Design of siRNA

[0088] Two siRNAs for ZFPM2-AS1 were designed using the online siRNA design tool: siRNA #1 , SEQ ID NO.5 (ctgattaagacggttgaaactag); and siRNA #2 , SEQ ID NO. 6 (gacaggttatcaacgaaacttct).

[0089] 3. Transfection

[0090] Gastric cancer cells AGS were divided into three groups, which were blank control group (transfected with nonsense siRNA), siRNA group #1 (transfection siRNA #1 ) and siRNA group #2 (transfection siRNA #2 ).

[0091] The siRNA concentration was 50nM, and the medium was changed 6 hours after transfection.

[0092] 4. Total RNA extraction and expression detection and analysis of ZFPM2-AS1

[0093] Cell samples were collected after 48 hours, and the subsequent specific steps were the same as in Example 2.

[0094] 5. Results

[0095] The result is as image 3 As shown, compared with the control gro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the technical field of medical biological detection. The present invention provides a new application of ZFPM2-AS1, specifically the application in the preparation of a gastric cancer diagnostic kit. The present invention further provides a quantitative PCR detection for ZFPM2-AS1 for A kit and detection method for the diagnosis of gastric cancer. The kit and detection method of the present invention are simple, reliable, short in cycle, high in specificity, and easy for clinical popularization.

Description

technical field [0001] The invention relates to the technical field of medical biological detection, and relates to the application of lncRNA as a molecular marker in the diagnosis of gastric cancer, and in particular to the application of ZFPM2-AS1 in lncRNA in the preparation of gastric cancer diagnostic reagents or kits. Background technique [0002] Gastric cancer is one of the major disease burdens in my country. At present, the commonly used treatment methods for gastric cancer include surgery, radiotherapy, chemotherapy, and targeted therapy, but the above-mentioned treatment methods are still limited for the treatment of advanced gastric cancer. [0003] The discovery of the molecular biological basis in the development of gastric cancer and the corresponding diagnostic and therapeutic molecular markers have important clinical significance. Long non-coding RNA is a kind of non-coding RNA, which is defined as non-coding RNA with a length greater than 200bp. In the p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12Q1/686
CPCC12Q1/686C12Q1/6886C12Q2600/158C12Q2600/178C12Q2545/114
Inventor 孔凡扬邓萱孔祥毓李兆申杜奕奇朱建伟鲍一朱惠云王宇欣
Owner SHANGHAI CHANGHAI HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com