Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Microorganism and uses thereof

A gene editing and protein technology, applied in the field of bioengineering, can solve problems such as not widely used, Cas9 protein cannot be expressed correctly, sgRNA is not transcribed correctly, etc.

Inactive Publication Date: 2018-08-10
WUHAN J1 BIOTECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The CRISPR / Cas9 system is a powerful genome editing method, which has been successfully applied to a variety of genomes, but it is not widely used in fungi. There are many reasons for this. In some fungi, effective genetic manipulation vectors cannot be established. , Cas9 protein cannot be expressed correctly, sgRNA is not transcribed correctly, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microorganism and uses thereof
  • Microorganism and uses thereof
  • Microorganism and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1. Construction of clones of purified Cas9 proteins

[0026] Using primer 1: ATATCATATGCCCAAGAAGAAGCGCAAGGTC and primer 2: AATTGGATCCTTAGCACTTCTTCTTCTTGGCCTGACCAGCCTTCTTGGTAGCAGCAGGACGCTTGTACAGCTCGTCCATGCCGA to amplify Cas9 protein and add nuclear localization sequence (NLS) and cysteine ​​at its end. Among them, the NLS sequence facilitates the entry of the Cas9 protein into the nucleus, and the cysteine ​​facilitates the engagement of the Cas9 protein with the cell-penetrating peptide (CPP). The fragment of the Cas9 protein amplified with the above primers was digested by NdeI and BamHI and cloned on the pET28 plasmid after digestion with the same enzyme, so that the Cas9 protein expressed in connection with the active cutting protein of NLS and Cas9 could be obtained. The Cas9 protein nucleotides contained therein are as follows:

[0027]ATGCCCAAGAAGAAGCGCAAGGTCGGTATCCACGGCGTTCCTGCCGCTGACAAGAAGTACTCCATCGGTCTCGACATCGGCACCAACTCCGTCGGTTGGGCTGTTATCACCGACGAGTACAA...

Embodiment 2

[0028] Embodiment 2: purify Cas9 protein

[0029] Transform pET28-Cas9 into BL21, draw about 50-60 single clones from each plate and inoculate them into 10 mL of LB medium with kanamycin resistance, and culture in a shaker at 37°C for 2-3 hours. Inoculate 500 mL of LB medium with kanamycin resistance at 1%, put it into a shaker at 37°C at 220rpm and cultivate until the OD value is between 0.6-0.8 (about 2h). After adding IPTG with a final concentration of 0.5mM, the temperature was changed to 30°C, and the shaker was incubated at 220rpm for about 18h.

[0030]Put the cultured bacteria liquid into the collection bottle, centrifuge at 3500rpm for 15min, remove the supernatant, repeat several times until the bacteria are collected, then resuspend and wash the bacteria once with sterile water, centrifuge at 3500rpm for 15min, remove the supernatant After the cells were homogenized, the supernatant was collected and filtered with a 0.45 μm filter membrane. The standard HIS-tagged...

Embodiment 3

[0032] Example 3 Cas9 is linked with cell penetrating peptide to form CPP-Cas9 protein

[0033] Mix purified 1mg of Cas9 protein with 50mg of cell penetrating peptide

[0034] (4-maleimidobutyryl-GGGRRRRRRRRRLLLL, medium peptide) mixed at room temperature, inverted and mixed for 2 hours, centrifuged and concentrated with a 50kDa protein centrifugal concentration column (millipore) to remove unbound polypeptides, collected linked CPP-Cas9 protein, and measured protein concentration .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Fungus has wide applications in biotechnology. CRISPR / Cas9 system is a powerful genome editing method and is successfully applied to a plurality of genomes, but the system is not widely used in fungus, and thus, a convenient, effective and widely applicable method which uses CRISPR / Cas9 system to perform gene editing in fungus is provided.

Description

technical field [0001] The present invention relates to the field of bioengineering, in particular, the present invention relates to a microbial gene editing method and its application. Background technique [0002] Fungi have a wide range of applications in biotechnology. The CRISPR / Cas9 system is a powerful genome editing method, which has been successfully applied to a variety of genomes, but it is not widely used in fungi. There are many reasons for this. In some fungi, effective genetic manipulation vectors cannot be established. , Cas9 protein cannot be expressed correctly, sgRNA is not transcribed correctly and other reasons. Therefore, a convenient, effective and widely applicable method is urgently needed to apply this technology in fungi. Contents of the invention [0003] The present invention aims to solve one of the technical problems in the related art at least to a certain extent. [0004] The CRISPR / Cas9 system is a powerful genome editing method, which ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10C12N9/22C12N15/113
CPCC12N9/22C12N15/102C12N15/113
Inventor 刘然刘天罡
Owner WUHAN J1 BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com