ACCase mutant protein enabling plant to have herbicide resistance, and application thereof
A mutant and herbicide technology, applied in the field of plant protein and plant herbicide resistance, can solve the problem of undetermined mechanism of herbicide action
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Embodiment 1: The process of obtaining quizalofop herbicide-resistant mutants in rice
[0058] Divide 120 kg of Zhennuo No. 19 (gifted by Zhenjiang Agricultural Science Institute in the hilly area of Jiangsu) (this is M0, soaked in water for 2 hours) in 6 times with 0.4-0.6% (w / w) ethyl methanesulfonate (EMS) at room temperature Soak under water for 6-9 hours, shake the seeds every 1 hour during this period; discard the EMS solution, soak the seeds 5 times in tap water, 5 minutes each time, then rinse the seeds with tap water overnight, sow in the field the next day, and perform routine fertilizer and water management (this is M1). After the plants are mature, the seeds are mixed, dried, and stored for the winter. Sow in the field the following year. When the rice (this is M2) seedlings grow to the three-leaf stage, spray 3mL quizalofop / L water (recommended minimum use concentration is 1.5mL quizalofop / 1L water), and it will still be normal green after 1 month. And...
Embodiment 2
[0059] Example 2: Obtaining the full-length gene of wild-type Accase in rice Zhennuo 19
[0060] Genomic DNA was extracted from the leaves of Zhennuo 19 wild-type plants, and primers were designed according to the Nipponbare ACCase gene in NCBI (NCBI: XM_015783727) for amplification, and KOD DNA polymerase (purchased from Toyobo Company) was used to amplify the ACCase gene. The reaction system is as follows:
[0061] 10×Buffer5.0μl
[0062] 10 μM forward primer (GTCAGATTTCACACATCTGGGGAT) 1.0 μl
[0063] 10 μM reverse primer (ACTTGCACTTTCATCTGGCAGAAC) 1.0 μl
[0064] 20-30ng / μL rice Zhennuo 19 genomic DNA 1.0μl
[0065] 2mMdNTP 2.0μl
[0066] 25mM MgSO 4 2.0μl
[0067] KOD DNApolymerase polymerase (1U / μl) 1.0μl
[0068] Add sterile water to a total volume of 50 μl
[0069] The PCR amplification reaction program adopts a two-step method, annealing and extension are combined together, and 68 degrees are used.
[0070]The program is as follows: pre-denaturation: 94°C for ...
Embodiment 3
[0073] Example 3: Molecular level identification of quizalofop herbicide-resistant rice mutants
[0074] Among all the herbicide-resistant rice mutant plants obtained in the above-mentioned Example 1, the leaves of multiple mutant plants and the leaves of Zhennuo No. 19 wild-type plant were selected, and genomic DNA was extracted respectively, and ACCase-F (GTCAGATTTCACACATCTGGGGAT) and ACCase-R ( ACTTGCACTTTCATCTGGCAGAAC) for PCR amplification, respectively. The PCR amplification conditions and amplification system were the same as in Example 2. The sequencing results found that: compared with the wild-type plants in Example 2, we obtained five rice mutants in total. mutations occurred. The specific mutation content is as follows:
[0075] In the ACCase gene sequence of the ACCase-5374 mutant, the 5374th nucleotide of its nucleotide sequence is mutated from A to T, resulting in the 1792nd amino acid mutation of its encoded amino acid sequence from isoleucine to leucine, It...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap