A kinase gene lerlk1-v and its expression vector and application
An expression vector and gene technology, applied in the field of kinase gene LeRLK1-V and its expression vector, can solve problems such as rapid virulence variation, outbreak of wheat powdery mildew, agricultural production disaster, etc., and achieve the effect of improving resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1 Cloning of a kinase gene LeRLK1-V with lectin and LRR domains in the wheat-P.
[0024] The Wheat-Glutella pilosa translocation line 6VS / 6AL Nannong 9918 is a wheat variety containing the broad-spectrum powdery mildew resistance gene Pm21 bred by the Institute of Cytogenetics of Nanjing Agricultural University (Gongzhi Gonggong, Chen Peidu, Zhang Shouzhong, Wang Xiu'e, Wang Suling, Zhou Bo, Feng Yi Gao, Liu Dajun. Nannong 9918, a new wheat variety resistant to powdery mildew and high yield. Journal of Nanjing Agricultural University, 2002,25(4):1438-1444). In the early stage, multiple 6VS transformation sequences have been developed on the 6VS of Nannong 9918, and the small fragment insertion translocation line NAU418 was further used to limit Pm21 between 6EST258 and CINAU15, and there are two 6EST243 and 6EST238 in the chromosome interval where Pm21 is located Marking (known and public, Radiation-induced translocations with reduced Haynaldia villosa chromatin...
Embodiment 2
[0027] Example 2 The expression of LeRLK1-V was induced by powdery mildew in the translocation line 6VS / 6AL Nannong 9918 of wheat-P.
[0028] Using the cDNA samples of the wheat-Tamophila translocation line 6VS / 6AL Nannong 9918 induced by powdery mildew for different periods of time as templates, primers P3 (TCCGCAGTTATCACATCAGC, SEQ ID NO.5) and P4 (CATTCTTGCATCCAATGC , SEQ ID NO.6) was used as primer for Q-PCR analysis. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uL PCR reaction system contains 10uL of 2×SYBR Green PCR Master Mix, 0.5μM primers P3 and P4, and 2uL of reverse transcription cDNA template. The amplification parameters were: 95°C for 10 minutes, then 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 1 minute, a total of 40 cycles. After the reaction, the measurement of the melting curve was carried out. The detected ...
Embodiment 3
[0029] Example 3 Construction of LeRLK1-V Gene Transient Expression Vector
[0030]Using the LeRLK1-V gene cDNA cloned in Nannong 9918 induced by powdery mildew as a template, the primer pair NLR1-V-BamHI-F (GGAGAGAACACGGGGGATCCATGGATCTATGCGTAGTGATTCTCC, SEQ ID NO.7) and NLR1-V-StuI-R (AACGTCGTATGGGTAAGGCCTCTATCTCATTGCAGGACCAGCAG, SEQ ID NO.8) was amplified by PCR, and the amplified fragment was recovered. The amplified product was double digested with BamHI and StuI, and the digested product was inserted into the vector pBI220 (Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higherplants.EMBO J.1987,6:3901-3907.), put LeRLK1-V at the multiple cloning site behind the 35S promoter. Thus, the target gene LeRLK1-V was cloned to the downstream of the strong promoter 35S, and the expression vector pBI220:LeRLK1-V( figure 2 ). It was verified by sequencing that the vector was constructed successfully.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com