Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer and probe composition for detecting HPV (Human Papillomavirus) high-risk type 16 by applying RPA (Recombinase Polymerase Amplification) technology

A technology of technical detection and composition, which is applied in the field of biological science and biology, can solve the problems of cumbersome test procedures of thermal cycler and difficulty in meeting the detection needs, and achieve the effect of high sensitivity and high accuracy

Inactive Publication Date: 2018-07-27
JIANGSU YINUOWAN CELL CLINIC CO LTD
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the main method of nucleic acid detection is the PCR method. Conventional PCR detection requires a special thermal cycler and cumbersome test procedures, and it is difficult to meet the detection needs of the field or other conditions outside the laboratory.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe composition for detecting HPV (Human Papillomavirus) high-risk type 16 by applying RPA (Recombinase Polymerase Amplification) technology
  • Primer and probe composition for detecting HPV (Human Papillomavirus) high-risk type 16 by applying RPA (Recombinase Polymerase Amplification) technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1: the establishment of detection method

[0028] Primers and probes were designed according to the genome sequence of HPV high-risk type 16 in GenBank. The length of the primer is about 30-35bp. Since there is no primer design software for RPA at present, a large number of primers were designed and synthesized in the previous work of the present invention, and a pair of primers with high sensitivity and good specificity were screened out. The primers and probe sequences are as follows: Table 1 shows.

[0029] Table 1: Primers and probes for RPA detection of HPV high-risk type 16

[0030] Primer name

sequence 5'-3'

HPV16-RPAF (SEQ ID No.1)

CAATTAAATGACAGCTCAGAGGAGGAGGATGAA

HPV16-RPAR (SEQ ID No.2)

CAACAAAAGGTTACAATATTGTAATGGGCTC

HPV16-RPAP

TGACAGCTCAGAGGAGGAGGATGAAATAGA(FAM-dT)(dSp)G(BHQ1-dT)CCAGCTGGACAAG(Spacer C3)

[0031] 1. Materials and methods

[0032] (1) Materials The hospital identified 6 cases of ...

Embodiment 2

[0041] Example 2: Application in Clinical Samples

[0042] The RPA method established in Example 1 was used to test the cervical cotton swab samples of 12 clinical suspected cases in China. The AxyPrep Mag Magnetic Bead Method Body Fluid Viral DNA / RNA Mini Kit from Axygen Company extracted the total nucleic acid DNA in various materials according to the product instructions, and then used the RPA method to detect whether these samples contained HPV high-risk type 16. At the same time, the human papillomavirus (HPV) type 16 and type 18 nucleic acid detection kit (fluorescent PCR method) (Shanghai Zhijiang Biological) kit was used to detect 12 samples in parallel. Results The detection results of the two detection methods were consistent, and all 12 samples were positive for HPV high-risk type 16. The above results show that the results obtained by the primer set, probe and detection method of the present invention are consistent with the results of PCR, which proves the reliab...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and probe composition for detecting HPV (Human Papillomavirus) high-risk type 16 by applying an RPA (Recombinase Polymerase Amplification) technology. A forward primersequence is shown as SEQ ID No. 1, a backward primer sequence is shown as SEQ ID No. 2 and a probe sequence is shown as SEQ ID No. 3. According to the method provided by the invention, a lot of RPA primers and probes are designed according to an HPV high-risk type 16 genome sequence, and one pair of the primer and probe composition capable of rapidly and effectively detecting HPV high-risk type 16 nucleic acid is screened. By applying a primer pair, a probe and a corresponding kit, provided by the invention, rapid constant-temperature fluorescence detection can be carried out on an HPV high-risk type 16 DNA (Deoxyribonucleic Acid) segment in unknown samples including woman cervical epithelial cells, genitalsecretion and the like. A detection result can be used for auxiliary diagnosis of HPV high-risk type 16 infection and early screening of cervical carcinoma, follow-up of cervical lesions and guidance of development of vaccines.

Description

technical field [0001] The invention belongs to the field of biological science and biotechnology, in particular to a primer and probe composition for detecting HPV high-risk type 16. That is, primer pairs, probes and detection methods for rapid detection of HPV high-risk type 16 using recombinase polymerase amplification (Recombinase Polymerase Amplification, RPA) technology. Background technique [0002] Human papillomavirus (Human Papillomavirus, HPV) belongs to the Papillomaviridae family, is a small molecule, non-encapsulated circular double-stranded DNA virus, the genome length is about 8000 base pairs (bp), divided into 3 Functional regions, namely early transcribed region (E region), late transcribed region (L region) and non-transcribed region (long control region, LCR). HPV infects humans through direct or indirect contact with contaminated objects or through sexual transmission. The virus is not only host-specific but also tissue-specific, and can only infect hu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/708C12Q2521/507C12Q2522/101C12Q2563/107
Inventor 唐乃平曾骥孟龚剑方月蒙明慧
Owner JIANGSU YINUOWAN CELL CLINIC CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com