Primer and probe composition for detecting HPV (Human Papillomavirus) high-risk type 16 by applying RPA (Recombinase Polymerase Amplification) technology
A technology of technical detection and composition, which is applied in the field of biological science and biology, can solve the problems of cumbersome test procedures of thermal cycler and difficulty in meeting the detection needs, and achieve the effect of high sensitivity and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1: the establishment of detection method
[0028] Primers and probes were designed according to the genome sequence of HPV high-risk type 16 in GenBank. The length of the primer is about 30-35bp. Since there is no primer design software for RPA at present, a large number of primers were designed and synthesized in the previous work of the present invention, and a pair of primers with high sensitivity and good specificity were screened out. The primers and probe sequences are as follows: Table 1 shows.
[0029] Table 1: Primers and probes for RPA detection of HPV high-risk type 16
[0030] Primer name
sequence 5'-3'
HPV16-RPAF (SEQ ID No.1)
CAATTAAATGACAGCTCAGAGGAGGAGGATGAA
HPV16-RPAR (SEQ ID No.2)
CAACAAAAGGTTACAATATTGTAATGGGCTC
HPV16-RPAP
TGACAGCTCAGAGGAGGAGGATGAAATAGA(FAM-dT)(dSp)G(BHQ1-dT)CCAGCTGGACAAG(Spacer C3)
[0031] 1. Materials and methods
[0032] (1) Materials The hospital identified 6 cases of ...
Embodiment 2
[0041] Example 2: Application in Clinical Samples
[0042] The RPA method established in Example 1 was used to test the cervical cotton swab samples of 12 clinical suspected cases in China. The AxyPrep Mag Magnetic Bead Method Body Fluid Viral DNA / RNA Mini Kit from Axygen Company extracted the total nucleic acid DNA in various materials according to the product instructions, and then used the RPA method to detect whether these samples contained HPV high-risk type 16. At the same time, the human papillomavirus (HPV) type 16 and type 18 nucleic acid detection kit (fluorescent PCR method) (Shanghai Zhijiang Biological) kit was used to detect 12 samples in parallel. Results The detection results of the two detection methods were consistent, and all 12 samples were positive for HPV high-risk type 16. The above results show that the results obtained by the primer set, probe and detection method of the present invention are consistent with the results of PCR, which proves the reliab...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com