Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Creation and application of heavy metal super-enriched genetically-engineered rape genetically modified with Sedum plumbizincicola SpNramp5 gene

A technology of transgenic engineering and sedum associated with ore is applied in the field of creation and application of transgenic engineering rapeseed with super-accumulation of heavy metals, which can solve the problems of special growth environment, heavy metal return, limited tolerance, etc., and achieves good genetic transformation effect and high expression level. High and promising effect

Inactive Publication Date: 2018-06-22
西安泽睿环境科技有限公司
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a heavy metal super-enrichment transgenic engineering rapeseed with Sedum sedum SpNramp5 gene and its application, so as to solve the problems of limited tolerance, slow growth, small biomass, special growth environment, and heavy metal return

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Creation and application of heavy metal super-enriched genetically-engineered rape genetically modified with Sedum plumbizincicola SpNramp5 gene
  • Creation and application of heavy metal super-enriched genetically-engineered rape genetically modified with Sedum plumbizincicola SpNramp5 gene
  • Creation and application of heavy metal super-enriched genetically-engineered rape genetically modified with Sedum plumbizincicola SpNramp5 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Cloning of SpNramp5 gene

[0048] Grind Sedum sedatus seedlings into powder using liquid nitrogen, extract its RNA using the Trizol method, and reverse-transcribe it into cDNA using the TOYOBO reverse transcription kit, and use Primer5 to design the cDNA sequence of the SpNramp5 gene provided by NCBI. Downstream primers, and synthetic primers, the nucleotide sequence of the designed primers is:

[0049] Upstream sequence: 5'TTCCGGCCTTCGACTTTGACG 3' (as shown in SEQ ID NO: 2);

[0050] Downstream sequence: 5'AACCGTTAACGCGCATTCGCACA 3' (shown in SEQ ID NO: 3).

[0051] After the primers are synthesized, dissolve them with 1×TE, and then carry out PCR amplification, using the cDNA of S. It was amplified by GXL Premix, and the amplified product was electrophoresed on 1% agarose gel, and the target band was excised and recovered using a gel recovery kit. The electrophoresis of the amplified product is as follows figure 1 As shown, the band indicated by the arro...

Embodiment 2

[0052] The construction of the transformation vector of embodiment 2 heavy metal hyperaccumulation transgenic plants

[0053] (1) The construction of the transformation vector containing Ubiquitin promoter, Bar screening gene and 3×Flag tag is based on the laboratory’s own pCAMBIA1301-3×Flag vector, which is obtained after transformation through the following steps:

[0054] ① Obtaining the Bar screening gene: the pCAMBIA3301 vector contains the Bar screening gene and the CaMV35S promoter. In this example, the CaMV35S promoter that comes with the pCAMBIA3301 vector is used to start the Bar screening gene, which can enhance the efficient transformation of the target gene. The CaMV35S promoter core The nucleotide sequence is shown in SEQ ID NO:9. The pCAMBIA3301 vector was cut with Xho I endonuclease, the digested product was subjected to 1% agarose gel electrophoresis, and a small band (608bp) was recovered. Homologous recombination primers were designed according to the pCAMB...

Embodiment 3

[0065] Example 3 SpNramp5 Gene Overexpression Binary Vector of Heavy Metal Hyper-enrichment Transgenic Plants

[0066] Design homologous recombination primers according to the two ends of the ORF region of the SpNramp5 gene, the nucleotide sequence of the designed homologous recombination primers is:

[0067] Upstream sequence (shown as SEQ ID NO: 12):

[0068] 5'TTCTGCAGGTCGACTCTAGAGGATCCATGGCATCAACTGTCGGAAACGC3';

[0069] Downstream sequence (shown as SEQ ID NO: 13):

[0070] 5'CTTTGTAGTCGGTACCCGGGGATCCCTCTAAGACAGCTCTGCGTTGCGG3'.

[0071] The 19T vector containing SpNramp5 was used as a template for PCR amplification using high-fidelity enzymes. The PCR product was subjected to electrophoresis on 1% agarose gel, and the target band was recovered for future use. The constructed pUb-3×Flag-Bar transformation vector and p2×CaMV35S-HYG transformation vector were respectively digested with BamH I, and the digested products were directly gel-recovered for future use. Carry ou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses creation of heavy metal super-enriched genetically-engineered rape genetically modified with a Sedum plumbizincicola SpNramp5 gene. The creation comprises steps as follows: theSpNramp5 gene in Sedum plumbizincicola is cloned; based on a plant expression vector, a transformation vector containing a strong promoter and a screening gene is established, the SpNramp5 gene is inserted into the transformation vector with a homologous recombination method, and an overexpression binary vector is obtained; the overexpression binary vector is transformed into a hypocotyl segmentof the rape by agrobacterium tumefaciens, genetically-modified seedlings are cultured, and genetically-modified positive plants are screened, wherein the transgenic receptor plants are cabbage type rape K407. According to the culture method, the problems of limited endurance, slow growth, small biomass, special growing environment, heavy metal return and the like of a wild heavy metal enriched plant can be solved. Besides, the invention further provides an application of the heavy metal super-enriched genetically-modified plant obtained through the creation of the heavy metal super-enriched genetically-engineered rape genetically modified with the Sedum plumbizincicola SpNramp5 gene to restoration of heavy metal contaminated soil.

Description

technical field [0001] The invention belongs to the field of transgenic plants and heavy metal pollution control, and specifically relates to the creation and application of heavy metal hyper-enrichment transgenic engineering rapeseed transformed with Sedum sedum SpNramp5 gene. Background technique [0002] Heavy metal pollution has become a major environmental problem worldwide. Heavy metal pollution not only threatens the production and development of animals, plants and microorganisms, but also threatens human health and even life through the food chain. Heavy metals that cause soil pollution mainly include As, Cd, Co, Cr, Cu, Hg, etc., which are generally compound pollution of several heavy metals. Heavy metal pollution in heavy metal mining areas and high-speed economic development areas is particularly serious, resulting in many agricultural products in our country being refused to enter the international market due to excessive heavy metals. [0003] Various countrie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/29C12N15/66A01H4/00A01H5/00A01H6/20B09C1/10
CPCA01H4/00B09C1/105C07K14/415C12N15/8271
Inventor 罗颜荣陈坤明袁博李永辉吴兆锋魏伟刘捷白帆
Owner 西安泽睿环境科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com