Chicken coccidiosis ATG (Autophagy Related Protein) Etatg6 encoding gene sequence and acquiring method thereof
An autophagy-related protein and coding gene technology, which is applied to the coding gene sequence of the autophagy-related protein Etatg6 in chicken coccidia and its acquisition field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] In order to make the technical means, creative features, goals and effects of the invention easy to understand, the present invention will be further elaborated below in conjunction with specific illustrations.
[0021] A chicken coccidia autophagy-related protein Etatg6 coding gene sequence and its acquisition method, the material selection day-old Lingnan yellow broiler chicken, 102 full price broiler chicken feed, does not contain any anticoccidial drugs and antibacterial drugs, strains, worm strains and carriers E. tenella (Guangdong strain) oocysts, E. coli DH5α and plasmid vector pMD18-T easy were used respectively, the upstream primer Etatg6-F was 5'ATGGTGGACACAGATTCTCCCCCAGCG3', and the downstream primer Etatg6-R was 5'TTACGGTGCAGAGCCCGCCACCAAG3'.
[0022] The specific method is: step 1, take E.tenella sporulated oocysts, count, dilute to 5.0*10 4 per mL, orally infect 2-4 week-old chickens, inoculate 1 mL each, collect the feces 5 days after inoculation and sep...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com