Primer, kit and method for detecting pseudomonas aeruginosa and clostridium perfringens
A technology of Pseudomonas aeruginosa and Clostridium perfringens, applied in biochemical equipment and methods, microorganism-based methods, microorganisms, etc., can solve the problem of detection of Pseudomonas aeruginosa and Clostridium perfringens See reports and other issues to achieve good industrialization prospects, reasonable components and ratios, and shorten the detection cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0043] The present invention detects the primers of Pseudomonas aeruginosa and Clostridium perfringens in water, and the sequences of the primers are respectively:
[0044] It is characterized in that the 20.0 μL reaction system in the kit includes the following components: 10.0 μL of 2×ddPCR Super Mix, 0.1-1.0 μL of forward and reverse primers for Pseudomonas aeruginosa and Clostridium perfringens, and 0.1-1.0 μL for each probe 0.1-1.0 μL, DNA template 4.0 μL.
Embodiment 2
[0046] The present invention is a kit for detecting Pseudomonas aeruginosa and Clostridium perfringens in water, wherein the 20 μL reaction system comprises the following components:
[0047] Among them, 10.0 μL of 2×ddPCR Super Mix, 1.0 μL of forward and reverse primers for Pseudomonas aeruginosa and Clostridium perfringens, 1.0 μL of each probe, and 4.0 μL of DNA template.
[0048] Wherein the primer sequences are as follows:
[0049] Upstream primer P.AF: TGGTAGTCCACGCCGTAAA
[0050] Downstream primer P.AR:CAGACTGCGATCCGGACTACG
[0051] Probe P.AP: TCGACCGCCTGGGGAGTACG
[0052] Upstream primer C.PF: TTGATAGCGCAGGACATGTT
[0053] Downstream primer C.PR: CATGTAGTCCACTGTTCCAGCA
[0054] Probe C.PP: ACAGCAGGTTGCAAAACTAATGAGGC.
Embodiment 3
[0056] The present invention detects the method for Pseudomonas aeruginosa and Clostridium perfringens in water, comprises the following steps:
[0057] A. Extract sample DNA;
[0058] B. Add each reaction component to the above 20.0 μl reaction system, then add 70.0 μl mineral oil, mix well and transfer to the droplet generator to automatically generate droplets;
[0059] C. Carefully transfer all the generated micro-droplets to the PCR reaction tube of the 96-well reaction plate; then seal the 96-well reaction plate on a film sealing machine, and place it in an ordinary PCR machine for PCR reaction.
[0060] D. Open the application software of the droplet fluorescence detector, insert the 96-well reaction plate after the PCR reaction directly into the device, detect the PCR reaction of the droplet in each PCR reaction tube, and finally calculate the copy of the gene to be tested according to the Poisson distribution law number.
[0061] Wherein the primer sequences are as ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com