Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method of RNA G-quadruplex

A quadruplex and sulfur technology, which is applied in the field of RNAG-quadruplex detection and detection kits for RNAG-quadruplex, can solve the problems to be improved, etc.

Active Publication Date: 2017-10-20
INST OF CHEM CHINESE ACAD OF SCI
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, current methods for the detection of RNA G-quadruplexes still need to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of RNA G-quadruplex
  • Detection method of RNA G-quadruplex
  • Detection method of RNA G-quadruplex

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Embodiment 1 prepares sample

[0061] The samples used in the following examples are as follows:

[0062] Sample 1: RNA G-quadruplex sample, the RNA G-quadruplex used in the following examples is also called VEGF, and VEGF has the nucleotide sequence shown in SEQ ID NO:1.

[0063] GGAGGAGGGGGAGGAGGA (SEQ ID NO: 1).

[0064] VEGF was synthesized by Guangzhou Ruibo Biological Co., Ltd. Dissolve VEGF in Tris-HCl (containing K + ) solution, the final concentration of VEGF was 20 micromole / liter, and after heating to 90° C., and then naturally cooling down to room temperature, sample 1 was obtained.

[0065] Sample 2: single-stranded RNA sample, the single-stranded RNA used in the following examples is also called Af22, and Af22 has the nucleotide sequence shown in SEQID NO:2.

[0066] UGAGCUUAAUUGUAUAUAUAUUCG (SEQ ID NO:2).

[0067] Af22 was synthesized by Guangzhou Ruibo Biological Co., Ltd., and Af22 was dissolved in Tris-HCl (containing K + ) solution, the final co...

Embodiment 2

[0071] Embodiment 2 detects RNA G-quadruplex

[0072] 1. Preparation of reaction solution (solution A, solution B, solution C)

[0073] 1) Solution A

[0074] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 20 μL of 20 μmol / L sample 1 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mixed to obtain solution A, wherein the molar ratio of RNA G-quadruplex to Thioflavin T was 0.5:1.

[0075] 2) Solution B

[0076] Add 4 microliters of 200 micromol / liter high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 20 microliters of 20 micromol / liter sample 2 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mixed to obtain solution B, wherein the molar ratio of single-stranded RNA to Thioflavin T was 0.5:1.

[0077] 3) Solution C

[0078] Add 4 microliters of 200 micromol / liter high-purity aqueous solution of Thioflavin T to a 2mL reaction tube, and then use ...

Embodiment 3

[0092] Embodiment 3 detects RNA G-quadruplex

[0093] 1. Preparation of reaction solution (solution A, solution B, solution C)

[0094] 1) Solution A

[0095] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 40 μL of 20 μmol / L sample 1 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mix well to obtain solution A, wherein the molar ratio of RNA G-quadruplex to Thioflavin T is 1:1.

[0096] 2) Solution B

[0097] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 40 μL of 20 μmol / L sample 2 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mixed to obtain solution B, wherein the molar ratio of single-stranded RNA to Thioflavin T was 1:1.

[0098] 3) Solution C

[0099] Add 4 microliters of 200 micromol / liter high-purity aqueous solution of Thioflavin T to a 2mL reaction tube, and then use Tris-HCl (containing K + ) soluti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
strengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses an application of thioflavin-T to kit preparation, a method for determining presence of RNA G-quadruplex in a to-be-detected sample and a kit for detecting RNA G-quadruplex. The method for determining presence of RNA G-quadruplex in the to-be-detected sample comprises the following step: (1) the to-be-detected sample makes contact with thioflavin-T, a mixed solution is obtained accordingly, and the fact that the to-be-detected sample contains RNA is determined in advance; (2) the mixed solution is subjected to ultraviolet-visible absorption spectrum analysis; (3) whether RNA G-quadruplex is present in the to-be-detected sample is determined on the basis of an ultraviolet-visible absorption spectrum analysis result, wherein according to the ultraviolet-visible absorption spectrum analysis result, the maximum absorption peak of thioflavin-T is at 424-544 nm, which indicates that the to-be-detected sample contains RNA G-quadruplex. The method for determining presence of RNA G-quadruplex in the to-be-detected sample has the characteristics of being simple and convenient to operate, high in sensitivity and high in accuracy.

Description

technical field [0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to methods for detecting RNA G-quadruplexes. More specifically, the present invention relates to the use of Thioflavin T in the preparation of a kit, a method for determining whether there is RNA G-quadruplex in a sample to be tested, and a kit for detecting RNA G-quadruplex. Background technique [0002] The RNA G-quadruplex is a secondary structure formed by guanine-rich RNA sequences. The basic unit of the structure is a G-tetrad planar structure formed by three or four guanine bases through Hoogsteen hydrogen bonds. In the presence of cations (such as potassium ions or sodium ions), a unique parallel-structured G-quadruplex is formed through the stacking of multiple G planes. In the study of human transcriptional genes, it was found that many genes closely related to the occurrence and development of malignant tumors (such as NRAS, ZIC1, MT3-M...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/31G01N21/64
CPCG01N21/314G01N21/6486G01N2021/3155
Inventor 唐亚林许淑娟李骞
Owner INST OF CHEM CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com