Method for regulating content of starch in corn kernel based on ZmMIKC2a gene
A technology of starch content and amylose content, applied in the field of genetic engineering, can solve the problem of less research on corn quality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] The present embodiment provides a kind of method that improves corn grain amylose content and amylose / total starch ratio, comprises the following steps:
[0036] (1) Cloning of ZmMIKC2a gene
[0037] Grain endosperm of corn B73 variety 16 days after pollination was selected, and corn endosperm RNA was extracted and reverse-transcribed into cDNA. Using corn endosperm cDNA as a template, according to the gene sequence published in the corn B73 genome database, combined with the pZZ00005 plant expression vector (vector map as shown in figure 1 Shown) design primers for the multiple cloning site, perform PCR amplification, and obtain PCR amplification products.
[0038] The primer sequences are:
[0039] MIKC2a-F-1:5′-CGC GGATCC ATGGGTAGGGGAAGGATTGA-3′
[0040] MIKC2a-R-1:5′-AA CTGCAG TTAGAACTGATGATGAGGGTTATTG-3′
[0041] The PCR reaction program was: 98°C, pre-denaturation for 10 min; 98°C, denaturation for 20 s; 60°C, annealing for 20 s; 72°C, extension for 2 min, ...
Embodiment 2
[0068] The present embodiment provides a kind of method that reduces corn grain amylose content and amylose / total starch ratio, comprises the following steps:
[0069] (1) Cloning of ZmMIKC2a gene RNAi interference sequence MIKC2a-RNAi
[0070] The grain endosperm of corn B73 variety 16 days after pollination was used as raw material to clone the ZmMIKC2a gene and connect it to the T vector to obtain the recombinant plasmid T-MIKC2a. For specific steps, refer to step (1) of Example 1.
[0071] Using T-MIKC2a as a template, according to the ZmMIKC2a gene sequence, combined with the pUCCRNAi interference vector (the vector map is as follows image 3 Shown) design primers for the multiple cloning site, perform PCR amplification, and obtain PCR amplification products.
[0072] The primer sequences are:
[0073] MIKC2a-RNAi-F:GC TCTAGA GTCGCCTCTACGAGTATGCCAACA
[0074] MIKC2a-RNAi-R:GG ACTAGT TGACAGGTTTCCCACGGAATCAC
[0075] The PCR reaction program was: 98°C, pre-denatur...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com