Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting spirodela polyrrhiza Sp6 microsatellite marker by means of specific primers

A technology of microsatellite marker and purple-backed duckweed, which is applied in the fields of biochemical equipment and methods, and the determination/inspection of microorganisms, and achieves the effects of fast speed, simple method, high accuracy and sensitivity

Active Publication Date: 2017-08-18
ZHEJIANG OCEAN UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The detection method of the invention has the advantages of rapidity, accuracy, sensitivity, etc., and can intuitively detect the genotypes of different individuals of the rusty spot, so as to quickly obtain the polymorphism map of the genetic variation of the functional gene microsatellite locus of the rusty spot, the microsatellite Markers can be applied to the fields of genetic variation and population genetic diversity analysis of rust spot moth, but there is still room for improvement in the detection speed of microsatellite markers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting spirodela polyrrhiza Sp6 microsatellite marker by means of specific primers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Such as figure 1 As shown, the method for detecting the Sp6 microsatellite marker using specific primers is as follows:

[0029] 1) Material pretreatment: collect duckweed samples, domesticate, package, dry and set aside;

[0030] 2) Genomic DNA extraction of Duckweed: a. Preheat the CTAB extract solution in a water bath; b Grind the sample and transfer it to a centrifuge tube, add the extract solution, keep warm, and mix evenly by inversion; c Centrifuge, take the supernatant; d Add phenol / chloroform, mix well, centrifuge, take supernatant; e add chloroform, mix well, centrifuge, take supernatant; f repeat d, e 1~2 times; g add isopropanol, mix well, precipitate, centrifuge , discard the supernatant; h rinse the precipitate with ethanol, centrifuge, and discard the supernatant; i repeat h; j detect, store at low temperature, and set aside;

[0031] 3) Design specific primers:

[0032] Microsatellite Sp6-specific primer: F: GAACCTTAATATGCGACCAAG

[0033] R: CAAGAAAG...

Embodiment 2

[0046] Such as figure 1 As shown, the method for detecting the Sp6 microsatellite marker using specific primers is as follows:

[0047] 1) Material pretreatment: collect duckweed samples, domesticate, package, dry and set aside;

[0048] 2) Genomic DNA extraction of Duckweed: a. Preheat the CTAB extract solution in a water bath; b Grind the sample and transfer it to a centrifuge tube, add the extract solution, keep warm, and mix evenly by inversion; c Centrifuge, take the supernatant; d Add phenol / chloroform, mix well, centrifuge, take the supernatant; e add chloroform, mix well, centrifuge, take the supernatant; f repeat d, e preferably once; g add isopropanol, mix well, precipitate, centrifuge , discard the supernatant; h rinse the precipitate with ethanol, centrifuge, and discard the supernatant; i repeat h; j detect, store at low temperature, and set aside;

[0049] 3) Design specific primers:

[0050] Microsatellite Sp6-specific primer: F: GAACCTTAATATGCGACCAAG

[005...

Embodiment 3

[0064] Such as figure 1 As shown, 1) plant material collection: use ordinary fishing nets to collect Duckweed samples from natural waters such as rivers, ponds, ditches, and paddy fields, and the minimum interval between samples is 20m. The collected fresh Duckweed is first domesticated in the laboratory using tap water for 3-5 days, and then 20-40 Duckweed plants (including roots) with connected leaves are selected as genomic DNA extraction samples, that is, a clone. Each sample was individually packaged in a paper sample bag and dried with silica gel to prepare a dry sample.

[0065] 2) DNA extraction of Duckweed Genome: The modified CTAB method was used for DNA extraction, and 0.5 g of leaves were taken from each sample for DNA extraction.

[0066] a) Preheat the CTAB extract in a 65°C water bath;

[0067] b) Grind the sample quickly in liquid nitrogen, transfer the powdered material into a 2mL centrifuge tube, add preheated CTAB extract (3-5ml of extract per gram of samp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for detecting a spirodela polyrrhiza Sp6 microsatellite marker by means of specific primers. The detection method comprises the steps of 1, conducting material pretreatment, wherein a spirodela polyrrhiza sample is acquired, cultured, packaged and dried for use; 2, extracting spirodela polyrrhiza genomic DNA; 3, designing the specific primers: microsatellite node Sp6 specific primers: F: GAACCTTAATATGCGACCAAG R: CAAGAAAGTCAAATACAGCGG; 4, conducting PCR amplification on genomic DNA of spirodela polyrrhiza individuals in different proles by means of the primers; and 5, conducting preliminary screening on a PRC product, adding loading buffer, and conducting vertical electrophoresis analysis on denatured polyacrylamide gel after denaturing, so as to obtain a polymorphic map about large genetic diversity of spirodela polyrrhiza in an Sp6 core sequence area. By the adoption of the method, the polymorphic map about large genetic diversity of a spirodela polyrrhiza Sp6 genetic marker locus can be obtained fast. The method is simple.

Description

technical field [0001] The invention belongs to the technical field of DNA molecular markers, in particular to a method for detecting microsatellite markers of Duckweed Sp6 by using specific primers. Background technique [0002] Microsatellites or simple sequence repeats (SSR) refer to simple tandem repeat DNA sequences composed of 1-6 nucleotides, which exist in almost all organisms studied so far, and the distribution density is very high. big. Because microsatellites are widely distributed in the genome, they have the characteristics of high density, rich polymorphism, high heterozygosity and good stability, co-dominant inheritance following Mendelian segregation law, and easy PCR amplification, etc., and have become widely used in recent years. DNA markers are often used in many research fields such as family pedigree authentication of biological resources, gene linkage analysis, genetic map construction, germplasm identification, and population genetic diversity. [...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q1/6895C12Q2600/156C12Q2525/151C12Q2565/125
Inventor 徐娜娜朱明栋胡芳露
Owner ZHEJIANG OCEAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com