Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Report system applied to plant pathogenic bacterium type III secretion system, and application thereof

A technology of plant pathogenic bacteria and secretion system, applied in the field of reporting system, can solve problems such as no records

Inactive Publication Date: 2017-07-04
SHENYANG SINOCHEM AGROCHEMICALS R&D CO LTD
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no record or demonstration that it can be used as an inhibitor of the type III secretion system of plant pathogenic bacteria and used in the field of agricultural fungicides.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Report system applied to plant pathogenic bacterium type III secretion system, and application thereof
  • Report system applied to plant pathogenic bacterium type III secretion system, and application thereof
  • Report system applied to plant pathogenic bacterium type III secretion system, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Acidovorax citrulli, which infects melon and causes fruit spot disease, is used as the control object.

[0074] The reporter pathogenic bacteria is a deletion mutation of Acidovorax citrulli (NCBI Accession: NC_008752.1) that causes bacterial fruit spot of melons by deleting the β-lactamase synthesis gene penP (NCBI GeneID: 4667746,) body. That is, A.citrulliΔpenP, which is A. citrulliΔpenP, is the Acitrulli watermelon that lacks the 224th to 815th nucleotide sequence of penP.

[0075] Specifically: According to the genome information of Acitrulli watermelon (A.citrulli) (NCBI Accession: NC_008752.1), the upstream and downstream PCR primers for β-lactamase penP (NCBI GeneID: 4667746) were designed, and the sequence of a pair of upstream PCR primers was penP- F1:TAGAATTCTGGTGAGCAGGCGC and penP-R1:TAGGATCCGTTTGAAGGTGCTGCAC; a pair of downstream PCR primers are penP-F2:TAGGATCCGGAGCAGCGCG and penP-R2:TATCTAGAGGCATCCGCACCG. The upstream and downstream base fragments of pe...

Embodiment 2

[0078] see figure 1 , The high-throughput screening method for inhibitors of type III secretion system of plant pathogenic bacteria is as follows: the reporter system A.citrulliΔpenP (pZAC-3502sig-penP) cultivated to the stable growth phase is used at pH 5.8, containing 10mM MgCl 2 LB (Luria-Bertani) culture solution, diluted 100 times, distributed to 96-well cell culture plate according to 200 μL per well, and then added to the wells of the plate with the compound solution to be screened at a final concentration of 100 μg / mL, at 28 ° C, After culturing for 48 hours, add nitroceftin solution with a final concentration of 25 μg / mL to the wells of the plate, and judge the biological activity of the compound according to the color change of the solution. If the color of the solution remains orange, it indicates that the compound has an inhibitory effect on the type III secretion system, and the β-lactamase synthesized by the reporter system in the cell cannot be secreted to the ...

Embodiment 3

[0088] Embodiment 3 utilizes above-mentioned screening to obtain compound as active component, obtains 10% water emulsion

[0089] In percent by weight, 10% of No. 29 compound in Table 1 obtained by screening the above examples, polyvinyl alcohol 0.8%, alkyl aryl polyoxyethylene polyoxypropylene ether 8.5%, agricultural milk 2201 16%, dimethyl formaldehyde Amide 11%, Ethylene Glycol 5%, Water to make up to 100%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to an agricultural bactericide, and concretely relates to a report system applied to a plant pathogenic bacterium type III secretion system, and an application thereof. The system comprises a report pathogen and a report vector, wherein the report pathogen contains the plant pathogenic bacterium type III secretion system, and the report vector is an expression vector containing beta-lactamase synthesis gene and a type III secretion system signal peptide. The invention provides a brand new high-flux screening method for screening type III secretion system inhibitors based on the interaction of beta-lactamase and a chromogenic substrate nitrocefin. The bacterium type III secretion system is artificially induced to express, a report vector gene product is transferred to the outside of a cell, and reacts with the chromogenic substrate, and whether the type III secretion system is inhibited or not is judged according to the color change. Secondary amine type III secretion system inhibitors are found by using the method.

Description

technical field [0001] The invention belongs to agricultural fungicides, in particular to a reporting system applied to the type III secretion system of plant pathogenic bacteria and its application. Background technique [0002] The type III secretion system is of great significance to the pathogenicity of pathogenic bacteria, including plants, animals and human pathogenic bacteria. Under suitable environmental conditions, when pathogenic bacteria come into contact with the host, the type III secretion system forms a needle-like structure under the regulation of related genes. The base of the structure is anchored on the wall membrane structure of the bacteria, and the tip dissolves the host cell. The cell wall and cell membrane of the bacterial cell enter the interior of the cell, and then introduce various pathogenic effector proteins synthesized in the bacterial cell into the infected cell through the needle tube structure. These pathogenic effector proteins can disrupt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12Q1/34A01N43/40A01N43/58A01P1/00
CPCA01N37/50A01N43/40A01N43/42A01N43/56A01N43/78C07C255/62C07D213/61C07D215/14C07D231/12C07D231/14C07D277/24C07D277/64C07D277/82C07C255/64C07D277/28A01N33/24
Inventor 陈亮刘君丽英君伍陈霖司乃国杨辉斌李斌孙宝祥
Owner SHENYANG SINOCHEM AGROCHEMICALS R&D CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com