Application of TEL gene in regulation and control of agronomic characters of Zea mays
A technology of agronomic traits and genes, applied in the direction of application, genetic engineering, and the use of vectors to introduce foreign genetic materials, etc., to achieve the effect of increasing corn yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1, the cloning of TE1 gene expression cassette in maize and the construction of transformation vector
[0038] According to the TE1 gene polynucleotide sequence in the gene bank, PCR primers were designed to amplify the TE1 gene from the maize (Zea mays) genome. Since the TE1 gene is relatively large, the full-length gene, including the promoter, protein coding region and terminator, was obtained by 2 PCR fragments. The first fragment, including the promoter and part of the protein coding region, was amplified using the following PCR primers: ZMte3-13F (5'AAGCTTAGTGCCAATCACTGCGTGAGA) and ZMte-22R (5'CCTCGGGCTCCTTGAACAGGAA). The second fragment, including part of the protein coding region and the terminator, was amplified using the following PCR primers: ZMte-32F (5'TCGCAGGGGACTTGAAGGATGTGA) and ZMte-42R (5'GGTACCTATTTAAGATCTCACTTCAAGCTCTATGA). These two fragments were respectively cloned into pMD19-T vector. Then, the first fragment was excised from pMD19-T...
Embodiment 2
[0040] Embodiment 2, the cloning of maize TE1 gene cDNA
[0041] Cloning of TE1 gene cDNA in maize (Zea mays): PCR primers ZmTE1-F (5'GAGGATCCAACAGAATTCATGGGTGGGTTC) and ZmTE1-R (5'GCGGTCTAGATTACTAGTCGTCGTAGCCAAGC) were designed and amplified by PCR using the total cDNA of commercial maize variety Zhengdan 958 as a template The cDNA fragment of TE1 is about 2 kb in size. The PCR reaction conditions are: 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 2 minutes, repeating 33 cycles; 72°C for 10 minutes. The obtained PCR product of approximately 2 kb was cloned into the T-vector pMD19. Then, ZmTE1 was obtained by double digestion with BamHI and XbaI, and DNA sequence determination showed that its nucleotide sequence was correct (SEQ ID NO: 2). Afterwards, the cDNA obtained by enzyme digestion and the synthetic terminator ter1 (nucleotide sequence is SEQ ID NO: 8) are connected by XbaI to obtain a nucleotide sequence with a structure of ZmTE1-ter1, which ...
Embodiment 3
[0042] Embodiment 3, the cloning of tissue-specific promoter
[0043] Obtaining the ZmGA20ox1 promoter (pZmGA20ox1) of maize (Zea mays) gibberellin synthase gene: Design PCR primers pZmGA20ox1-F (5'TAAGCTTCTGCCATGACGTGATTGTCCCTGGC) and pZmGA20ox 1-R (5'GGGATCCAGGAGGGAGGAAGCAGAGGAGGAG) to the genome of commercial maize variety Zhengdan 958 As a template, pZmGA20ox1 was obtained by PCR amplification. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 2 minutes, repeating 30 cycles; and then 72°C for 10 minutes. The obtained PCR product of approximately 2 kb was cloned into the T-vector pMD19. Then, the corresponding promoter pZmGA20ox1 was obtained by double digestion with HindIII and BamHI, and DNA sequence determination showed that the nucleotide sequence of the promoter was correct (SEQ ID NO: 6).
[0044] Cloning of maize (Zea mays) auxin import carrier1 (AUX1) gene promoter (pAUX1): artificially synthesized AUX1 gene p...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com