Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific primer for detecting Salmonella pullorum, kit containing the primer and application thereof

A technology for salmonella and pullorum, which is applied in the field of biotechnology detection to achieve the effects of high sensitivity, simple operation, and prevention of false elimination.

Active Publication Date: 2020-07-14
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at the problems that Salmonella pullorum is prone to occur in the detection process, the object of the present invention is to provide a kind of primer and detection method thereof for rapid and specific detection of Salmonella pullorum

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer for detecting Salmonella pullorum, kit containing the primer and application thereof
  • Specific primer for detecting Salmonella pullorum, kit containing the primer and application thereof
  • Specific primer for detecting Salmonella pullorum, kit containing the primer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Primer Design

[0023] A comprehensive bioinformatics analysis was performed on the whole genome of pullorum, typhoid and Salmonella enteritidis serotypes in GenBank, and finally the SEEP17495 gene (shown in SEQ ID NO.1) was determined as the detection target gene of pullorum pullorum.

[0024] According to the SEEP17495 gene, specific primers were designed using Oligo 6 software, and the primers were synthesized by Suzhou Jinweizhi Company. The primer sequences are as follows:

[0025] SEEP17495-idF: 5'CGATAATGGCAACCGCACTG 3' (shown in SEQ ID NO.2);

[0026] SEEP17495-idR: 5'TGATGTCTGCCCCTTTCGAC 3' (shown in SEQ ID NO.3).

Embodiment 2

[0027] Example 2: Establishment of PCR detection method for Salmonella pullorum serotype

[0028] 1. Experimental strains and reagents

[0029] The experimental strains are shown in Table 1, among which 11 isolates were isolated and identified by the Animal Bacteriosis Laboratory of Harbin Veterinary Research Institute.

[0030] Premix Ex Taq DNA polymerase and Marker DL2000 were purchased from TaKaRa Company.

[0031] Table 1 Experimental strains

[0032]

[0033]

[0034] Note: a: China Veterinary Microbiology Collection Management Center; b: China Medical Bacteria Collection Management Center; c: China Industrial Microbiology Culture Collection Management Center; d: American Type Culture Collection;

[0035] 2. Method

[0036] Step 1, DNA template preparation

[0037] Inoculate the strains listed in Table 1 into 5mL LB broth, culture overnight at 37°C with shaking at 200rpm, add 1mL of overnight cultured bacteria solution into a 1.5mL Eppendorf centrifuge tube, ce...

Embodiment 3

[0044] Embodiment 3: the test of the detection sensitivity of chicken manure simulated sample

[0045] Mix 1 g of chicken manure sample after autoclaving with 1 ml of 10× diluted bacterial solution, add LB broth to make up to 5 ml, shake at 37°C and 200 rpm for 5 hours; centrifuge the culture solution at 3000 rpm for 3 minutes and take the supernatant, The genome was extracted by the above method, and used as a template for PCR amplification using the PCR method established in Example 2, and the product was detected by 1.5% agarose gel electrophoresis.

[0046] image 3 It shows the results of the sensitivity test for the detection of simulated samples of chicken manure. The results show that the minimum concentration of Salmonella pullorum in the chicken manure samples can be detected when the bacteria are enriched for 5 hours. 3 cfu / mL, but at a concentration of 10 2 The PCR amplification result is negative at cfu / mL or lower concentration, indicating that the PCR method o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific primer for detecting salmonella pullorum, a kit with the primer and application of the primer. Aiming at a specific fragment of salmonella pullorum, the primer for specific proliferation of salmonella pullorum is designed, and a PCR detection method capable of directly detecting salmonella pullorum in an excrement sample is established, the method is good in specificity, high in sensitivity and short in detection time, salmonella pullorum can be quickly and accurately detection from the excrement sample, but proliferation results of 19 kinds of other common pathogenic salmonella serotypes and 7 kinds of common non-salmonella pullorum are all negative. Thus, according to the provided specific primer for detecting salmonella pullorum, the kit with the primer and application of the primer, a fast and effective technical means is provided for detection of salmonella pullorum, moreover, the method is easy to operate and low in requirement for equipment, the whole detection process can be finished in only one day, and requirements of most poultry breeding plants on fast detection of salmonella pullorum can be met.

Description

technical field [0001] The invention relates to a specific primer for detecting Salmonella pullorum and a kit containing the primer, and also relates to a specific PCR method for rapidly detecting Salmonella pullorum using the primer and the kit. The invention belongs to biotechnology detection field, Background technique [0002] Salmonella (Salmonella) is one of the main food-borne pathogens, and its serotypes are numerous. There are more than 2,600 serotypes that have been identified, but only some specific Salmonella serotypes can infect humans and animals. Among them, Salmonella pullorum (S.pullorum) is a host-specific pathogen that seriously affects the development of my country's poultry breeding industry. It has a wide range of transmission and strong pathogenicity. It mainly infects chicks within 21 days of age and can cause white diarrhea. The mortality rate after infection is almost 100%. However, adult chickens usually have no clinical symptoms after being infect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/686C12Q1/10C12N15/11C12R1/42
CPCC12Q1/686C12Q1/689C12Q2565/125
Inventor 于申业刘思国曹俊
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com