Indirect competitive enzyme linked immunosorbent assay aptamer method used for detecting bovine parainfluenza virus 3 antibodies
A technology of bovine parainfluenza virus and enzyme-linked aptamer, which is applied in the field of bioengineering, can solve the problems of time-consuming laboratory conditions, complicated operation, and time-consuming, and achieve reduced economic losses, good specificity, and high positive detection rate effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] The HN protein solution described in this application is prokaryotically expressed and preserved by our laboratory;
[0047] Nucleic acid aptamer sequence WC-2:
[0048] 5’-BIO-CGGCGCATGCGTCGACCTGCAGCTAGTTAAAGGATAAGCAAGTCGCCGAGGCAACCAATGTGGGATCCGTCGACGAATTCCCTA was synthesized by Shanghai Sangon Bioengineering Co., Ltd. Synthesis method: single tube synthesis 10OD, molar weight 12nmol. When used, dissolve in 200 μL HEPES buffer and incubate at 95°C for 10 min. Rapid ice bath for 10 min and then set aside.
[0049] 1. The indirect competitive enzyme-linked aptamer method for detecting bovine parainfluenza virus type 3 antibodies is as follows:
[0050] Coating: Pipette 100 μL of HN protein solution and coat it in a 96-well ELISA microplate, overnight at 4°C.
[0051] Plate washing: Shake off the coating solution, wash the microwell plate three times with 300 μL HEPEST (HEPES containing 0.05% Tween 20), and spin dry.
[0052] Blocking: Add 200 μL of HEPES solution co...
Embodiment 2
[0080] 1. Determination of optimal HN coating concentration and Bio-WC-2 concentration
[0081] Different concentrations of HN protein were coated on the ELISA plate at 4°C overnight, and 1% BSA was used as the blocking solution. The optimal coating concentration of HN protein and the optimal reaction concentration of nucleic acid aptamer Bio-WC-2 were optimized by I-ELAA test. The results are shown in Table 1, choose OD 450 The value is close to 1 and the condition with the largest P / N value is the optimal condition, that is, the coating concentration of HN protein is 80ug / mL, and the optimum concentration of Bio-WC-2 is 50nM. In this experiment, the amount of Bio-WC-2 added was 100 μL, while the amount of Bio-WC-2 added in Ic-ELAA was 50 μL, then the concentration of Bio-WC-2 in the subsequent Ic-ELAA should be 100 nM.
[0082] Table 1 Determination of optimal HN coating concentration and Bio-WC-2 concentration
[0083]
[0084] 2. Determination of blocking solution
...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com