Supercharge Your Innovation With Domain-Expert AI Agents!

Primer combination for simultaneously identifying Chinese herb ginseng, American ginseng and radix notoginseng and application of primer combination

A combination of primers and American ginseng technology, which is applied in the direction of recombinant DNA technology, biochemical equipment and methods, and microbial measurement/inspection, can solve the problems of drug safety damage, mixed use of adulterants, and inability to identify adulterants

Active Publication Date: 2017-05-24
华润三九现代中药制药有限公司 +2
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because ginseng, Panax notoginseng, and American ginseng are closely related species of Panax genus with similar morphology and chemical composition, there is a phenomenon of mixing and mixing in the market, especially the common ginseng, American ginseng decoction pieces or ginseng flower, American ginseng flower, and Panax notoginseng mixed with each other in the market. In the case of mixed conditions, it will cause damage to the safety of medication, and it is necessary to establish an accurate and reliable identification method, especially one that can simultaneously detect whether there is mutual doping
[0003] At present, although there are reports on specific molecular markers and detection methods of ginseng and American ginseng, these technologies only focus on the identification of authentic ginseng products, and cannot identify whether there are adulterants. Adulterated samples require multiple PCR reactions to determine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer combination for simultaneously identifying Chinese herb ginseng, American ginseng and radix notoginseng and application of primer combination
  • Primer combination for simultaneously identifying Chinese herb ginseng, American ginseng and radix notoginseng and application of primer combination
  • Primer combination for simultaneously identifying Chinese herb ginseng, American ginseng and radix notoginseng and application of primer combination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0103] Embodiment 1, primer design

[0104] Extensive sequence analysis of the genomes of various Panax genus species yielded several primers for the identification of Panax ginseng, Panax notoginseng and American ginseng. Each primer was pre-tested to compare the performance of sensitivity and specificity, and finally three sets of primer pairs for identifying ginseng, Panax notoginseng and American ginseng were obtained.

[0105] The primer pair (primer pair I) used to identify ginseng consists of primer F1 and primer F2 (5'→3'):

[0106] F1 (sequence 1 of the sequence listing): TAACAATACCGGGCTGATAC;

[0107] F2 (sequence 2 of the sequence listing): CCAGTTAAGGACAGGAG;

[0108] The primer pair (primer pair II) used to identify Panax notoginseng consists of primer F3 and primer F4 (5'→3'):

[0109] F3 (sequence 3 of the sequence listing): AGGGATGAGGGGTGCGTAG;

[0110] F4 (sequence 4 of the sequence listing): CGACATGAGAAGAGGGCTTTTA;

[0111] The primer pair (primer pair II...

Embodiment 2

[0115] Embodiment 2, identification method optimization

[0116] 1. Optimization of annealing temperature

[0117] The samples to be tested are: ginseng (serial numbers 1 and 2 in Table 1), Panax notoginseng (serial numbers 10 and 11 in Table 1), American ginseng (serial numbers 16 and 17 in Table 1).

[0118] 1. Extract the genomic DNA of the sample to be tested.

[0119] 2. Take the genomic DNA obtained in step 1 as a template, and use the primer combination prepared in Example 1 to carry out PCR amplification.

[0120] PCR amplification system (25 μL): 2.5 μL 10×buffer, 1.6 μL dNTP (2.5 mM), 0.4 μL primer F1, 0.4 μL primer F2, 0.4 μL primer F3, 0.4 μL primer F4, 0.4 μL primer F5, 0.4 μL μL primer F6, 0.2 μL SpeedStar HS Taq DNA polymerase, 2 μL template (DNA content is 10 ng), 16.3 μL sterile double distilled water.

[0121] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s, annealing for 10 s, extension at 72°C for 20 s, a total of ...

Embodiment 3

[0140] Embodiment 3, establishment of identification method

[0141] 1. Agarose gel electrophoresis

[0142] 1. Extract the genomic DNA of the sample to be tested.

[0143] 2. Using the genomic DNA obtained in step 1 as a template, the primer combination prepared in Example 1 was used for PCR amplification to obtain an amplification product.

[0144] PCR amplification system (25 μL): 2.5 μL 10×buffer, 1.6 μL dNTP (2.5 mM), 0.3 μL primer F1, 0.3 μL primer F2, 0.2 μL primer F3, 0.2 μL primer F4, 0.25 μL primer F5, 0.25 μL primer F6, 0.2 μL SpeedStar HS Taq DNA polymerase, 2 μL template DNA, 17.2 μL sterile double distilled water.

[0145] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s, annealing at 60°C for 10 s, extension at 72°C for 20 s, a total of 35 cycles; extension at 72°C for 3 min.

[0146] 3. Perform 1.5% agarose gel electrophoresis on the amplified product obtained in step 2, and judge as follows according to the result:

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer combination for simultaneously identifying Chinese herb ginseng, American ginseng and radix notoginseng and application of the primer combination. The primer combination consists of six single-chain DNA molecules as shown in sequences 1 to 6. The invention also relates to application of the primer combination in identifying the ginseng, the American ginseng and the radix notoginseng. The detection method provided by the invention has a detection limit of 1 percent for the mutual doping of any two of the ginseng, the American ginseng and the radix notoginseng, and can meet the requirement on the production and inspection of Chinese herbs. The primer combination can be used for identifying roots, stems, leaves, flowers, fruits and processed products of the ginseng, the American ginseng and the radix notoginseng.

Description

technical field [0001] The invention relates to a combination of primers for simultaneous identification of traditional Chinese medicines ginseng, American ginseng and notoginseng and its application. Background technique [0002] Ginseng (Panax L.) plants are famous and precious medicinal plants, and all plants in the genus are used for medicinal purposes. "Chinese Pharmacopoeia" contains 6 kinds, including ginseng, American ginseng, Panax notoginseng, bamboo ginseng, pearl ginseng, and Panax notoginseng. Among them, ginseng, American ginseng, and notoginseng are the most important medicinal and functional food varieties of the genus Panax. Their roots, rhizomes, leaves, flowers, and fruits are all used for medicinal purposes and are of high value. In the clinical medicine of traditional Chinese medicine, ginseng is warm in nature and has the effect of nourishing vitality, solidifying body fluid, and calming the nerves; Sanqi is warm in nature, sweet and slightly bitter, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/6895C12Q2600/16C12Q2537/143C12Q2563/107C12Q2531/113
Inventor 袁媛蒋超黄璐琦赵玉洋
Owner 华润三九现代中药制药有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More