Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing pro-brain natriuretic peptide epitope by virtue of Bacillus brevis (B.brevis)

A technology of Bacillus brevis and antigenic epitopes, applied in the direction of microorganism-based methods, biochemical equipment and methods, chemical instruments and methods, etc., can solve the problems of high cost, complexity, poor stability, etc., and achieve high-efficiency expression and simplified separation Purification process, high practical value effect

Active Publication Date: 2017-03-22
DALIAN UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the high cost or poor stability of several other sources, the main source is recombinant E. coli
However, for the fusion protein recombinantly expressed in E. coli, the upstream protein expression requires IPTG induction, and the downstream protein purification requires a series of steps such as breaking cells, which is relatively complicated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing pro-brain natriuretic peptide epitope by virtue of Bacillus brevis (B.brevis)
  • Method for preparing pro-brain natriuretic peptide epitope by virtue of Bacillus brevis (B.brevis)
  • Method for preparing pro-brain natriuretic peptide epitope by virtue of Bacillus brevis (B.brevis)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] 1. Human fibronectin Fn3 displays NT-BNP 12-21 Construction of expression vector for linear epitope fusion protein:

[0029] (1) Using human fibronectin type III domain protein (Fn3) as the model gene (EMBL accession number AJ320527), NT-BNP 12-21 The linear epitope was designed in the FG region of Fn3, and the short peptide sequence encoding the BNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding the 12-21 amino acid residues LETSGLQEQR of BNP) was introduced in the FG loop region, and Nanjing GenScript Biotechnology Co., Ltd. was entrusted to follow the sequence List [1] Synthesis of Fn3-BNP 12-21 Gene, introduce a separation and purification tag encoding 6 histidines at the 5'end of the fusion gene to facilitate separation and purification; see the attached fusion gene structure figure 1 ;

[0030] (2) The above fusion gene Fn3-BNP 12-21 Constructed into shuttle vector pNCMO through NcoⅠ and XhoⅠ restriction sites 2 Downstream of the strong P2 promoter, forming a fusion ...

Embodiment 2

[0039] 1. Human fibronectin Fn3 displays NT-BNP 12-21 Construction of expression vector for linear epitope fusion protein:

[0040] (1) Using human fibronectin type III domain protein (Fn3) as the model gene (EMBL accession number AJ320527), NT-BNP 12-21 The linear epitope was designed in the FG region of Fn3, and the short peptide sequence encoding the BNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding the 12-21 amino acid residues LETSGLQEQR of BNP) was introduced in the FG loop region, and Nanjing GenScript Biotechnology Co., Ltd. was entrusted to follow the sequence List [1] Synthesis of Fn3-BNP 12-21 Gene, introduce a separation and purification tag encoding 6 histidines at the 5'end of the fusion gene to facilitate separation and purification; see the attached fusion gene structure figure 1 ;

[0041] (2) The above fusion gene Fn3-BNP 12-21 Constructed into shuttle vector pNCMO through NcoⅠ and XhoⅠ restriction sites 2 Downstream of the strong P2 promoter, forming a fusion ...

Embodiment 3

[0050] 1. Human fibronectin Fn3 displays NT-BNP 12-21 Construction of expression vector for linear epitope fusion protein:

[0051] (1) Using human fibronectin type III domain protein (Fn3) as the model gene (EMBL accession number AJ320527), NT-BNP 12-21 The linear epitope was designed in the FG region of Fn3, and the short peptide sequence encoding the BNP epitope (CTGGAAACCTCGGGCCTGCAGGAACAACGT, encoding the 12-21 amino acid residues LETSGLQEQR of BNP) was introduced in the FG loop region, and Nanjing GenScript Biotechnology Co., Ltd. was entrusted to follow the sequence List [1] Synthesis of Fn3-BNP 12-21 Gene, introduce a separation and purification tag encoding 6 histidines at the 5'end of the fusion gene to facilitate separation and purification; see the attached fusion gene structure figure 1 ;

[0052] (2) The above fusion gene Fn3-BNP 12-21 Constructed into shuttle vector pNCMO through NcoⅠ and XhoⅠ restriction sites 2 Downstream of the strong P2 promoter, forming a fusion ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing a pro-brain natriuretic peptide epitope by virtue of Bacillus brevis (B.brevis). According to the method, the nucleotide sequence of N-terminal pro-brain natriuretic peptide linear epitope (NT-BNP<12-21>) capable of being bound with a pro-brain natriuretic peptide antibody is replaced by the nucleotide sequence of a coding region FG of human fibronectin 3 (Fn3) to form a fusion gene of Fn3 and NT-BNP<12-21> linear epitope, the fusion gene is inserted into the downstream of a signal peptide P2 of shuttle plasmid pNCMO2 to construct recombinant plasmid pNCMO2-Fn3-NT-BNP<12-21>, and the recombinant plasmid is enabled to express the secretory fusion protein formed through fusion of the skeleton protein Fn3 and NT-BNP<12-21> linear epitope with high efficiency in B.brevis. The method disclosed by the invention is capable of simply and rapidly preparing the secretory fusion protein having the antigenicity equivalent to that of pro-brain natriuretic peptide with high efficiency and low cost.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for preparing a human fibronectin (Fn3) display antigen N-terminal brain natriuretic peptide (NT-BNP) linear epitope using a highly efficient secreted protein expression system. Background technique [0002] During the preparation of the ELISA test kit, the corresponding antigen needs to be used as a standard. Among them, protein antigens account for a large proportion. How to efficiently produce protein antigens is a technical key to such products. The present invention uses human fibronectin (Fn3) to display linear epitopes of protein antigens, and attempts to establish a general platform for efficiently producing secreted protein linear epitopes using Bacillus brevis. [0003] NT-BNP is released into human plasma when the myocardium is stimulated or lost. It has a long half-life in plasma, a high concentration, and is more stable in vitro. Therefore, NT-BNP as a standard detect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/75C12N15/62C07K19/00C12R1/08
CPCC07K14/58C07K14/78C07K2319/21C12N15/62C12N15/75
Inventor 胡学军孙慎侠丁宁杨春光李连保张婷
Owner DALIAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com