PCR detecting kit for fast identifying pullorum disease and chicken salmonella typhosa
A detection kit, a technology for Salmonella typhi, applied in the field of biotechnology detection, can solve the problems of time-consuming, unsuitable for routine detection, laborious and the like, and achieve a good repeatability effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1 bioinformatics method identifies the distribution of flhB gene
[0033] In NCBI, use the Blastn online comparison software (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to search the flhB gene in the genome-wide database, and the search results show that all pullorum and Salmonella gallinarum flhB genes The inside lacks the nucleotide sequence of 197bp, and its gene length is 83% of other serotype Salmonella flhB length ( figure 1 ).
[0034] The nucleotide sequence of pullorum and Salmonella gallinarum flhB is shown in SEQ ID NO.3, specifically:
[0035]GTGGCAGAAGAGAGCGACGACGACAAAACAGAAGCCCCCACACCCCACCGACTTGAAAAAGCGCGGGAAGAAGGGCAGATCCCCCGTTCCAGAGAACTGACCTCACTGCTGATATTGCTGGTGGGCGTTTGTATTATTTGGTTCGGCGGCGAGTCGTTAGCGCGGCAACTGGCGGGAATGCTCTCAGCAGGCCTGCACTTCGATCACCGTATGGTGAACGATCCTAACCTGATCCTGGGGCAGATAATTTTGCTGATTAAAGCGGCGATGATGGCACTGCTACCGCTCATCGCGGGCGTGGTACTGGTGGCGCTTATCTCGCCGGTTATGCTTGGCGGCCTGATTTTTAGCGGTAAGTCGCTACAGCCAAAATTTTCTAAATTAAACCCGCTGCCGGGAATTAAGCGCATGTT...
Embodiment 2
[0038] The preparation of embodiment 2 kit
[0039] Design and synthesis of primers: using the flhB gene as a template, design and analyze primers, and select the best pair of detection primers according to the genomic DNA sequence, in order to better display the intermediate fragments of the flhB gene deletion of pullorum and Salmonella gallinarum typhi The difference brought about by selecting the sequence near the missing fragment for primer design ( figure 2 ), its nucleotide sequence is shown in Table 1 below:
[0040] Table 1
[0041]
[0042] The above-mentioned primer pairs can be packaged individually, or can be made into a PCR detection solution. In the PCR detection solution, the amount of the above-mentioned primer pairs can be the conventional amount known to those skilled in the art.
[0043] That is to say, the kit of the present invention may contain the aforementioned independently packaged primer pair, or may contain a configured PCR detection solution...
Embodiment 3
[0045] Example 3 The kit detects the specific identification of pullorum and Salmonella gallinarum typhi
[0046] Using the primers in the kit described in Example 2, using the genomes of different serotypes of Salmonella and other bacteria as templates, the distribution characteristics of the flhB gene in different bacteria were identified by PCR.
[0047] The PCR reaction system is (25μL): ddH 2 O 16.25 μL, dNTP 2 μL, 10×PCR buffer 2.5 μL, flhB-F 1 μL, flhB-R 1 μL, template 2 μL, rTaq enzyme 0.25 μL.
[0048] The PCR program was 94°C for 5 minutes; 94°C for 45s, 55°C for 45s, 72°C for 30s, 30 cycles; 72°C for 10min.
[0049] The PCR product is carried out 1% agarose gel electrophoresis, and PCR electrophoresis result shows that all pullorum and Salmonella gallinarum typhi genomes all have 182bp objective band in the swimming lane of template ( image 3 ), while the amplified band of other serotypes of Salmonella was 379bp. It shows that with the specific flhB amplificatio...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com