Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Applications of ZNF367 gene in preparing medicines for treating breast cancer and reagents for realizing diagnosis and prognosis evaluation

A prognostic assessment, breast cancer technology, applied in gene therapy, drug combination, microbial determination/examination, etc., can solve problems such as lack of thorough research

Active Publication Date: 2016-10-26
SUN YAT SEN UNIV CANCER CENT
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role of ZNF367 in tumors and whether it can be used as a target for tumor diagnosis and treatment has not yet been thoroughly studied.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of ZNF367 gene in preparing medicines for treating breast cancer and reagents for realizing diagnosis and prognosis evaluation
  • Applications of ZNF367 gene in preparing medicines for treating breast cancer and reagents for realizing diagnosis and prognosis evaluation
  • Applications of ZNF367 gene in preparing medicines for treating breast cancer and reagents for realizing diagnosis and prognosis evaluation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: ZNF367 is upregulated in breast cancer

[0028] (1) Chip screening

[0029] Integrated analysis was performed by using multiple mRNA expression profiling chips of breast cancer and normal breast tissues.

[0030] Results: From the integrated microarray data of clinical tissue samples, it can be confirmed that the ZNF367 gene RNA level in tumor tissue is higher than that in normal breast tissue ( figure 1 -A); The samples of patients with clinical prognosis data were selected, and the relationship between the expression of ZNF367 and the prognosis of patients was analyzed, and it was found that the high expression of ZNF367 gene predicted the poor overall survival time of breast cancer patients ( figure 1 -B) and shorter disease-free survival time ( figure 1 -C).

[0031](2) qRT-PCR detection of the mRNA level of ZNF367 gene in breast cancer tissues and paired paracancerous tissues

[0032] Further qRT-PCR detection and verification of ZNF367 in breast can...

Embodiment 2

[0066] Example 2: Using small hairpin RNA (shRNA) to stably silence ZNF367 can inhibit the malignant phenotype of breast cancer

[0067] (1) Cell culture and stable strain construction

[0068] Methods: The negative control pSUPER-V and shRNA that can silence ZNF367 (shZNF367#1, shZNF367#2) were used to treat triple-negative breast cancer cells SKBR3 and BT549, respectively, at a working concentration of 5 nM. WB verification was carried out by harvesting the corresponding protein.

[0069] The sequence of shZNF367#1 is: ccgggcagatactgtccgcgattactcgagtaaatcgcggacagtatctgcttttt (SEQ ID NO: 5);

[0070] The sequence of shZNF367#2 is: ccgggagcagattcacccatgcaaactcgagtttgcatgggtgaatctgctcttttt (SEQ ID NO: 6);

[0071] Result: if image 3 As shown in -A, control cells SKBR3 pSUPER-V, BT549 pSUPER-V and ZNF367-silenced cells SKBR3 shZNF367#1, SKBR3 shZNF367#2, BT549 shZNF367#1, BT549shZNF367#2 were obtained respectively. β-tubulin was used as a control.

[0072] (2) Colony forma...

Embodiment 3

[0085]Example 3: Stable silencing of ZNF367 using locked nucleic acid (LNA) targeting ZNF367 can inhibit the malignant phenotype of breast cancer

[0086] (1) Cell culture and stable strain construction

[0087] Methods: Breast cancer cells SKBR3 and BT549 were treated with negative control LNA-NC and ZNF367-silencing LNA (LNA-ZNF367#1, LNA-ZNF367#2), respectively, at a working concentration of 50 nM. WB verification was carried out by harvesting the corresponding protein.

[0088] The sequence of LNA-NC is: TGagaagaccgttcttccaactTgG (SEQ ID NO: 7);

[0089] The sequence of LNA-ZNF367#1 is: TGaaccagcttgcctttcaaagTgG (SEQ ID NO: 8);

[0090] The sequence of LNA-ZNF367#2 is: TCtcatttcccaatacctcgccTgC (SEQ ID NO: 9);

[0091] Note: Lowercase letters are phosphorothioate-modified RNA bases, and uppercase letters are LNA bases.

[0092] Result: if Figure 4 As shown in -A, compared with the LNA-NC treatment group, the expression level of ZNF367 can be significantly reduced in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses applications of a ZNF367 gene in preparing medicines for treating breast cancer and reagents for realizing diagnosis and prognosis evaluation. The in vitro and vivo experimental result of the inventor proves that ZNF367 is highly expressed in the breast cancer tissue, and the survival analysis shows that the expression level of the ZNF367 gene is closely related to the staging and prognosis of breast cancer. Therefore, an inhibitor of the gene can be synthesized or prepared to be taken as the potential targeted medicine for breast cancer; the gene has DNA amplification and expression increase in the breast cancer, therefore, a kit for detecting the DNA variation and expression change of the gene can be prepared for diagnosing the breast cancer; the increase of the gene expression is related to the poor prognosis, and therefore, the kit for detecting the expression level change of the gene also can be used for prognosis evaluation thereof, so that the clinical treatment can be guided.

Description

technical field [0001] The invention specifically relates to the application of the ZNF367 gene in the preparation of drugs for treating breast cancer, reagents for diagnosis and prognosis evaluation. Background technique [0002] Malignant tumor is a disease that seriously endangers human life and health. In my country, about 3.07 million people suffer from cancer every year, and about 2.2 million people die from cancer every year. According to the 2012 World Cancer Report of the World Health Organization, there were 3.07 million newly diagnosed cancer cases in China, accounting for 21.8% of the global total; and 2.2 million annual deaths, accounting for 26.9% of the global annual cancer deaths. What's more serious is that these data are increasing year by year at an alarming rate. Malignant tumors have surpassed cardiovascular disease as the leading cause of death. Therefore, it is of great significance to human health to explore the molecular mechanism of cancer and fin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61K48/00C12Q1/68A61K39/395A61P35/00
CPCA61K39/39558A61K45/00A61K48/0058C12Q1/6886C12Q2600/118
Inventor 宋立兵李隽张鑫王曦林楚勇叶丽平
Owner SUN YAT SEN UNIV CANCER CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com