Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chimeric antigen receptor, gene and recombinant expression vector thereof, CAR20-NKT cell and preparation method and application thereof

A chimeric antigen receptor, NKT cell technology, applied in the field of tumor biological products, can solve the problems of need to improve specific killing activity, weak tumor killing effect, etc., achieve good industrial application prospects, strengthen specific killing activity, and prolong survival time. Effect

Inactive Publication Date: 2016-09-07
GENERAL HOSPITAL OF PLA
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to overcome the defects in the prior art that NKT cells have relatively weak killing effect on tumors, specific killing activity needs to be improved, and drug resistance caused by using anti-CD20 drugs to treat advanced CD20-positive B-cell lymphoma patients , providing a chimeric antigen receptor CD20ScFv-CD8-CD137-CD3ζ and its gene and recombinant expression vector, engineered CD20-targeted NKT cells (CAR20-NKT cells) and its preparation method and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor, gene and recombinant expression vector thereof, CAR20-NKT cell and preparation method and application thereof
  • Chimeric antigen receptor, gene and recombinant expression vector thereof, CAR20-NKT cell and preparation method and application thereof
  • Chimeric antigen receptor, gene and recombinant expression vector thereof, CAR20-NKT cell and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0030] There is no particular limitation on the preparation method of the lentiviral expression vector pWPXL-CD20ScFv-CD8-CD137-CD3ζ, which can be various methods conceivable by those skilled in the art. Preferably, the lentiviral expression vector pWPXL-CD20ScFv-CD8-CD137 -The preparation method of CD3ζ comprises the following steps:

[0031] (1) The hinge region and transmembrane region of CD8, the intracellular signaling domain of CD137 and the intracellular signaling domain of CD3ζ were respectively amplified from NKT cell cDNA, and cloned into the vector pWPXL-GFP to construct pWPXL-CD8 - CD137-CD3ζ;

[0032](2) Synthesize the nucleotide sequence encoding rat growth hormone signal peptide and CD20ScFv, and clone it into pWPXL-CD8-CD137-CD3ζ, and obtain pWPXL-CD20ScFv-CD8-CD137-CD3ζ with the correct sequence after sequencing verification.

[0033] In step (1), there is no particular limitation on the methods for respectively amplifying the hinge region and transmembrane r...

Embodiment 1

[0086] Example 1 Preparation of NKT cells

[0087] (1) Take human venous blood in a vacuum tube containing heparin. Mononuclear cells (PBMCs) were obtained by density gradient centrifugation using lymphocyte separation medium.

[0088] (2) After PBMCs were washed three times, the final concentration of cells was adjusted to 2×10 by using NKT cell culture medium GT-T551 containing 0.6 volume % human autologous serum. 6 cells / mL; the cells were inoculated on a 75 cm 2 in cell culture flasks. Then add recombinant human interleukin-2 with a final concentration of 500U / mL, 50ng / ml CD3 monoclonal antibody and 50ng / mL recombinant human interleukin-15 to the culture medium, at 37°C and saturated humidity of 5% CO 2 cultured in an incubator.

[0089] (3) On the 4th day of culture, transfer the cells to an uncoated culture flask, add NKT cell culture medium GT-T551 every 2 days according to the number of cell growth, and control the cell concentration to 1×10 8 cells / mL, and added ...

Embodiment 2

[0090] Example 2 Construction of lentiviral expression vector pWPXL-CD20ScFv-CD8-CD137-CD3ζ

[0091] (1) Preparation of NKT cell cDNA

[0092] The NKT cells cultured in Example 1 were centrifuged to precipitate, and the total RNA of the cells was extracted with RNAiso Reagent, a total RNA extraction kit, and stored at -80°C for future use. Extracted total RNA with RevertAid Reverse Transcription Kit TM NKT cell cDNA was reverse transcribed with First Strand cDNA Synthesis Kit and stored at -20°C for future use.

[0093] (2) Preparation of lentiviral plasmid pWPXL-CD8-CD137-CD3ζ

[0094] The following primer sequences were designed and synthesized (wherein, the underline marks are protected bases, and the square boxes are enzyme cleavage sites):

[0095] P1 (SEQ ID NO.11): GATC CTGAGCAACTCCATCATGTACTTC

[0096] MluI

[0097] P2 (SEQ ID NO.12): GATC GCAGTAAAGGGTGATAACCAGTGA

[0098] BglII

[0099] P3 (SEQ ID NO.13): GATC AAACGGGGCAGAAAGAAACTCC

[0100] BglII ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chimeric antigen receptor, a gene and a recombinant expression vector thereof, CAR20-NKT cell and a preparation method and application thereof. The chimeric antigen receptor is CD20ScFv-CD8-CD137-CD3 zeta, and comprises a rat growth hormone signal peptide, CD20ScFv, a hinge region and a transmembrane domain of CD8, an intracellular signaling structural domain of CD137 and an intracellular signaling structural domain of CD3 zeta, which are in series connection. The CAR20-NKT cells for the treatment of CD20 positive B cell lymphoma in progressive stage can effectively avoid the resistance caused by the existing drugs targeting CD20, have certain specific killing activity on cancer cells, and have certain therapeutic effect on patients with CD20 positive B cell lymphoma in progressive stage, who have been treated with multiple times of therapies (such as radiotherapy, chemotherapy and other drug symptomatic treatment) but without obvious curative effect.

Description

technical field [0001] The present invention belongs to the field of tumor biological products, and specifically relates to a chimeric antigen receptor CD20ScFv-CD8-CD137-CD3ζ in adoptive immunotherapy, its gene and recombinant expression vector, and engineered CD20-targeted NKT cells (CAR20 -NKT cell) and its preparation method and application. Background technique [0002] Natural killer cells (NKT) are a special type of T lymphocyte subsets with dual properties of T cells and NK cells. NKT cells can express TCR of T cells and NKR-P1 of NK cells. Under the mediation of TCR and NKR, NKT cells can produce a large amount of IL-4 and INFγ, which can kill tumor cells. NKT cells bind to the Fc region of specific antibodies through CD16 on their surface to exert antibody-dependent cell-mediated cytotoxicity (ADCC, antibody-dependent cell-mediated cytotoxicity). However, in the process of antibody-dependent cell-mediated killing, since the antibody can specifically bind to the c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10A61K39/00A61P35/00
Inventor 伍志强韩为东王晓慧王瑶郭业磊代汉仁张文英
Owner GENERAL HOSPITAL OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com