Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

IHF protein-based gene mutation method

A gene and protein technology, applied in the field of gene mutation based on IHF protein, can solve the problems of high requirements for transportation and storage methods, complicated preparation process, and low temperature resistance, and achieve the effect of reducing unnecessary interference

Inactive Publication Date: 2016-08-31
戚智青
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Usually, the preparation process of these recombinant enzyme components is relatively complicated, and they are not resistant to high temperature, and there are problems such as relatively high requirements for transportation and storage methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • IHF protein-based gene mutation method
  • IHF protein-based gene mutation method
  • IHF protein-based gene mutation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The preparation of embodiment 1 IHF protein

[0034] 1) IHF (NC_000913.3) is derived from Escherichia coli and is a member of the DNA binding protein DNABII family. It is a heat-resistant small molecular protein similar to histone that can bind to double-stranded DNA. IHF is composed of α subunit (himA code, 11.35kD) and β subunit (hip code, 10.65kD).

[0035] The IHFα or IHFβ subunit gene fragments derived from Escherichia coli were recombined and inserted into the PET-22b expression vector, and the recombinant vector was cloned after transformation, and the recombinant vector was further verified by colony PCR, restriction enzyme digestion and sequencing. The vector is named PET22-IHFα or pET22-IHFβ;

[0036] 2) Transform the constructed recombinant vector pET22-IHFα or pET22-IHFβ into protein expression engineering bacteria BL21 competent cells, screen positive clones on the ampicillin plate, pick positive clones and inoculate them into LB liquid medium with ampicil...

Embodiment 2

[0047] Example 2 Primer Design

[0048] 1) We use a gene sequence of Escherichia coli genome and send it to GenScript for gene fragment synthesis. The sequence of the gene fragment is shown in SEQ ID NO.1:

[0049] ATGAATAAATCTCCAATTGATCGACAAGATTGCTGCAGGGGCTGATATCTCTAAAGCTGCGGCTGGCCGTGCGTTAGAT CTATTATTGC TCCGTAACTGAATCTCTGAAAGAAGGGGATGATGTAGCACTGGTAGGTTTTGGTACTTTTGCCGTTAAAGAGCGTGCTGCCCGTACTGGCCGCAACCCGCAGACCGGTAAAGAGATCACCATCGCTGCTGCTAAAGTACCGAGCTTCCGTGCAGGTAAAGCACTGAAAGACGCGGTAAACTAA;

[0050] Mutation site: 79th G-C, 90th T-A, we will mutate the 79th and 90th positions of the original sequence. And the gene is divided into two DNA fragments with overlapping regions, the overlapping regions include mutation sites; the length of the DNA fragments in the overlapping regions is 15-25bp;

[0051] 2) Primer design: software used: GenSearch designs a pair of gene full-length amplification primers and at least a pair of mutation introduction primers, the present invention desig...

Embodiment 3

[0056] Embodiment 3 segmental PCR

[0057] 1) Segmented PCR amplifies the target gene, and introduces mutations in the overlapping region. The two tubes of PCR are shown in Table 2, and the system in each tube is 50 μl:

[0058] The first tube: add various reagents as shown in Table 2

[0059] Table 2 The first stage PCR reaction system

[0060] Reagent

Usage amount (μl)

Final concentration

2×Phusion Master Mix

25

1×

Primer 1

0.5

25pmol

Primer 2

0.5

25pmol

protogene fragment

1

Sterile distilled water

23

total capacity

50

[0061] The second tube: the addition of each reagent is shown in Table 3:

[0062] Table 3 The second stage PCR reaction system

[0063] Reagent

Usage amount (μl)

Final concentration

2×Phusion Master Mix

25

1×

Primer 3

0.5

25pmol

Primer 4

0.5

25pmol

protogene fragment

1 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an IHF protein-based gene mutation method. The method comprises designing a mutant primer, introducing the mutant in a primer overlapping area, carrying out recombinant cloning through an IHF protein replacing a homologous recombinase, carrying out segmented PCR amplification and full-length gene PCR amplification to obtain a full-length mutant gene and carrying out an IHF-mediated homologous recombination reaction process at the room temperature, wherein the homologous recombination effects are similar to the activity of the existing kit on the market and recombination efficiency is 95% or more. Mutant gene recombination cloning sequencing proves that the mutation is successful and thus the gene mutation method provided by the invention has feasibility. The gene mutation method has the advantages of simple operation, economy and low preservation and transport requirement conditions and has a large market application potential.

Description

technical field [0001] The application belongs to the field of genetic engineering, and in particular relates to a gene mutation method based on IHF protein. Background technique [0002] Gene mutation refers to abnormal changes in the structure, replication or phenotype function of individual dNMP (deoxynucleoside monophosphate) residues or fragments of DNA, also known as DNA damage. In vitro site-directed mutagenesis is an important method of gene research in the fields of contemporary biology and medicine. It can be applied to the transformation and optimization of target genes, gene function research, and the exploration of the functional relationship between regulatory sites of promoters, as well as the study of protein structure and function. A powerful tool for complex relationships between. [0003] Gene mutation is also the fundamental source of biological variation, providing raw materials for biological evolution. Gene recombination and gene mutation can produce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10
CPCC12N15/102
Inventor 戚智青王庆波
Owner 戚智青
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com