Tool for efficient site-specific transposition of genes and application of tool
A transgenic and efficient technology, applied in the field of genetic engineering, can solve problems such as safety and hidden dangers, and achieve the effect of efficient targeted transgenic
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 High-efficiency site-directed transgene vector for human ROSA26 locus
[0038] In this example, the high-efficiency site-directed transgene vector targeting human ROSA26 locus is taken as an example to illustrate the method for constructing the transgene tool (vector) of the present invention.
[0039] 1. Kpn1 and Fse1 double digested the PX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro (D-A) vector (purchased from Addgene), and the gel recovered fragments larger than 5bk. Gene synthesis aaaGGTACCCTGCAGCTAGCCTGCTGcaattgactatGTCGACactatggccggcccct fragment, Kpn1 and Fse1 double digestion, inserted into the recovered backbone vector to obtain vector 1 (Vector1).
[0040] 2. Use agaggtaccgcgttacataacttacggtaa and AGGCTAGcggatctgacggttcactaaaccagctct as upstream and downstream primers, use pEGFP-N1 (purchased from Shanghai Jiman Biology) as a template to amplify CMVpromoter, insert Kpn1 and Nhe double restriction enzymes into Vector1, select clone and ...
Embodiment 2 Embodiment 1
[0044] Example 2 Application of Example 1 Vector in High Efficiency Site-Specific Transgenesis
[0045] In this example, the EGFP-marked neomycin resistance gene is used as the exogenous target gene to illustrate the method of using the vector described in Example 1 to transfer the exogenous target gene efficiently and site-specifically.
[0046] 1. Online (http: / / crispr.mit.edu / ) design specific gRNA targeting human ROSA26 locus, first synthesize aaacGAGGCTGTGCTTCGGCGCTC and taaaGAGCGCCGAAGCACAGCCTC oligoDNA, mix 1:1 after dissolving in double distilled water, incubate at 94°C for 30s, 72 Incubate at ℃ for 2 minutes, insert and store on ice, take 0.5 μl of the mixture and add it to the Bsa1 enzyme-cut site-directed transposase expression plasmid, react with T4 ligase at 16℃ for 2 hours, heat shock at 42℃ to transform competent cells, and apply to ampicillin The LB solid medium culture plate was cultured overnight, the bacteria were picked and inoculated into the liquid LB med...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com