Recombinant Bacillus Calmette-Guerin vaccine and construction and application thereof
A technology of recombinant BCG and BCG, applied in the direction of recombinant DNA technology, the use of vectors to introduce foreign genetic material, bacterial antigen components, etc., can solve the problems of inability to protect adult tuberculosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 PtpA inhibits JNK and p38 signaling pathways
[0033] The Mycobacterium tuberculosis secretory protein PtpA, which can inhibit JNK and p38 signaling pathways, has an amino acid sequence shown in SEQ ID NO:1.
[0034] (A) Dual luciferase reporter system and WesternBlot experiment:
[0035] (1) Subculture 293T cells in good growth state into 24-well plates before testing, and culture overnight;
[0036] (2) Simultaneous transfection of pFA2-cJun, Gal4-Luc luciferase reporter gene plasmid, pRL-TK (Yisheng Biology) and RacL61 plasmid (insert the RacL61 gene into the p3xFlagCMV vector) in each well, transfection or no transfection at the same time Transfect the plasmid p3xFlagCMV14 containing the gene encoding PtpA as a control, and continue to cultivate for 6-8 hours;
[0037] Preparation of transfection solution: Take two EP tubes and prepare the following two solutions (the amount used for transfecting cells per 10 cm culture dish, the amount used for 24-well ...
Embodiment 2
[0048] Example 2 Recombinant BCG bacterial strain promotes cytokine secretion
[0049] (A) PtpA gene knockout method:
[0050] (1) The pJV53 plasmid (Addgene) was electrotransferred into BCG competent cells, and positive clones were screened on the Middlebrook7H10Agar (BD) plate containing kanamycin;
[0051] (2) Pick positive clones, inoculate them in Middlebrook 7H9 (BD) medium containing kanamycin resistance, and culture them at 37 degrees Celsius for 20 days, centrifuge to harvest BCG carrying pJV53k and prepare competent for use;
[0052] (3) Synthesis of ptpA gene upstream (AB) gene fragment
[0053] (AAGCTTCCCGCCCATGCATGAGACGCTGCGCGCCATGGGGCTCGGCGAATCCGCCGAGGAGGCGATCGTAGCCTACCGGGCCGACTACAGCGCCCGCGGTTGGGCGATGAACAGCTTGTTCGACGGGATCGGGCCGCTGCTGGCCGACCTGCGCACCGCCGGTGTCCGGCTGGCCGTCGCCACCTCCAAGGCAGAGCCGACCGCACGGCGAATCCTGCGCCACTTCGGAATTGAGCAGCACTTCGAGGTCATCGCGGGCGCGAGCACCGATGGCTCGCGAGGCAGCAAGGTCGACGTGCTGGCCCACGCGCTCGCGCAGCTGCGGCCGCTACCCGAGCGGTTGGTGATGGTCGGCGACCGCAGCCACGACGTCGA...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com