Method and kit used for determining human TERT gene rs2735940 site polymorphism
A site polymorphism and gene technology, applied in the field of determination of single nucleotide polymorphism, can solve the problems of non-existent diagnosis and treatment, and achieve the effects of lower measurement cost, good yield and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1 Extraction of Human Peripheral Blood Leukocyte DNA Determination of rs2735940 Polymorphism
[0059] 1 Materials and methods
[0060] 1.1 Main reagents and instruments
[0061] Reagents: 2×PCRMix (including 4 dNTP mixtures, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), restriction enzyme MspI (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.
[0062] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PharmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).
[0063] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested
[0064] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodium chloride salting-out method i...
Embodiment 2
[0090] Example 2 Determination of rs2735940 polymorphism in human peripheral blood whole blood samples:
[0091] The main reagents are the same as in Example 1 except that the endonuclease is BstNI; the apparatus is the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood genomic DNA and use it as a human genomic DNA template to be tested.
[0092] The sequence search was the same as in Example 1, and the primer sequences were designed as follows:
[0093] Upstream primer: 5'GTGTTTTCTATGTTGGCTTCTCTGC3' (SEQ ID NO: 7);
[0094] Downstream primer: 5'GCTCGCTGGAGGTTAGCCTCGTCTTGTAAATACTTAGGATT C C3' (SEQ ID NO: 8)
[0095] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration 0.1-1μM), 2×PCRMix 10μL (including 4 kinds of dNTP mixture, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 20 μl of the reactio...
Embodiment 3
[0113] Example 3 Determination of rs2735940 polymorphism in human peripheral blood clot specimen:
[0114] The main reagents are the same as in Example 1 except that the endonuclease is HpaII; the apparatus is the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.
[0115] The upstream primer used in the PCR reaction is SEQNO:11, and the downstream primer is SEQNO:12.
[0116] Upstream primer: 5'GAGAACCAGTGTAAGCTACAACTT3' (SEQ ID NO: 12);
[0117] Downstream primer: 5'TGGAGGTTAGCCTCGTCTTGTAAATACTTAGGATT C C3' (SEQ ID NO: 13)
[0118] For PCR amplification, except that the annealing temperature is 66° C., other reaction conditions are the same as in Example 1.
[0119] Enzyme digestion identification: Take 10 μl of the PCR product, add 5U of endonuclease HpaII, 2 μl of 10× enzyme digestion buffer and sterile double distilled water to form a 20 μl reaction system, digest in a 37°C ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com