Supercharge Your Innovation With Domain-Expert AI Agents!

Method and kit used for determining human TERT gene rs2735940 site polymorphism

A site polymorphism and gene technology, applied in the field of determination of single nucleotide polymorphism, can solve the problems of non-existent diagnosis and treatment, and achieve the effects of lower measurement cost, good yield and specificity

Inactive Publication Date: 2016-01-20
ZHENGZHOU UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology allows for precise control over how much magnesium (M) should react with another substance called DNA during an amplification process. By controlling this amount by adjusting certain factors like pH or temperature, it becomes possible to achieve better results without increasing costs compared to traditional methods that require multiple steps.

Problems solved by technology

This patented technical problem addressed in this patents relates to identifying which patients may develop diseases due to inherited differences between their own chromatin patterns called autism spectrum disorder syndrome(AS). AS causes abnormalities like growth retardations, behavioral changes, sensitivity to environmental factors, etc., making diagnosis difficult without exposure to harmful chemical agents. Current methods involve testing thousands of children at once over several years but they lack precision because these tests only provide limited results based upon known variations within each patient group.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit used for determining human TERT gene rs2735940 site polymorphism
  • Method and kit used for determining human TERT gene rs2735940 site polymorphism
  • Method and kit used for determining human TERT gene rs2735940 site polymorphism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 Extraction of Human Peripheral Blood Leukocyte DNA Determination of rs2735940 Polymorphism

[0059] 1 Materials and methods

[0060] 1.1 Main reagents and instruments

[0061] Reagents: 2×PCRMix (including 4 dNTP mixtures, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), restriction enzyme MspI (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.

[0062] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PharmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).

[0063] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested

[0064] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodium chloride salting-out method i...

Embodiment 2

[0090] Example 2 Determination of rs2735940 polymorphism in human peripheral blood whole blood samples:

[0091] The main reagents are the same as in Example 1 except that the endonuclease is BstNI; the apparatus is the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood genomic DNA and use it as a human genomic DNA template to be tested.

[0092] The sequence search was the same as in Example 1, and the primer sequences were designed as follows:

[0093] Upstream primer: 5'GTGTTTTCTATGTTGGCTTCTCTGC3' (SEQ ID NO: 7);

[0094] Downstream primer: 5'GCTCGCTGGAGGTTAGCCTCGTCTTGTAAATACTTAGGATT C C3' (SEQ ID NO: 8)

[0095] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration 0.1-1μM), 2×PCRMix 10μL (including 4 kinds of dNTP mixture, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 20 μl of the reactio...

Embodiment 3

[0113] Example 3 Determination of rs2735940 polymorphism in human peripheral blood clot specimen:

[0114] The main reagents are the same as in Example 1 except that the endonuclease is HpaII; the apparatus is the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.

[0115] The upstream primer used in the PCR reaction is SEQNO:11, and the downstream primer is SEQNO:12.

[0116] Upstream primer: 5'GAGAACCAGTGTAAGCTACAACTT3' (SEQ ID NO: 12);

[0117] Downstream primer: 5'TGGAGGTTAGCCTCGTCTTGTAAATACTTAGGATT C C3' (SEQ ID NO: 13)

[0118] For PCR amplification, except that the annealing temperature is 66° C., other reaction conditions are the same as in Example 1.

[0119] Enzyme digestion identification: Take 10 μl of the PCR product, add 5U of endonuclease HpaII, 2 μl of 10× enzyme digestion buffer and sterile double distilled water to form a 20 μl reaction system, digest in a 37°C ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit used for determining human TERT gene rs2735940 site polymorphism. The method comprises following steps: human genome DNA to be determined is provided; upstream primers and downstream primers used for amplification of sequences near human TERT gene rs2735940 site are provided, wherein the downstream primers possess mismatched base C; the human genome DNA to be determined is taken as a template, and the upstream primers and the downstream primers are used for PCR amplification so as to obtain amplification products containing CYGG or CCYGG segments, wherein Y is used for representing base C or T to be determined on human TERT gene rs2735940 site; a restriction enzyme is provided; the restriction enzyme is used for enzyme digestion of the amplification products so as to obtain corresponding enzyme-digested products; and it is determined that Y is used for representing base C or T based on the enzyme-digested products. The restriction enzyme is a restriction enzyme only used for realizing restriction digestion of one segment selected from CCGG and CTGG, or one segment selected from CCCGG and CCTGG. The method is rapid and reliable, and determination cost is reduced greatly.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner ZHENGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More