Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of long-chain non-coding RNA gene LOC553103 to preparation of nasopharyngeal darcinoma cell inhibitors

A long-chain non-coding, cancer cell technology, used in gene therapy, pharmaceutical formulations, anti-tumor drugs, etc.

Active Publication Date: 2016-01-13
CENT SOUTH UNIV
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previously, there was no literature report on the function of LOC553103

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of long-chain non-coding RNA gene LOC553103 to preparation of nasopharyngeal darcinoma cell inhibitors
  • Application of long-chain non-coding RNA gene LOC553103 to preparation of nasopharyngeal darcinoma cell inhibitors
  • Application of long-chain non-coding RNA gene LOC553103 to preparation of nasopharyngeal darcinoma cell inhibitors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1, real-time fluorescent quantitative PCR method detection confirmed that BART6-3p was up-regulated in nasopharyngeal carcinoma

[0073] 1. Materials and methods:

[0074] Collect 5 cases of normal nasopharyngeal epithelial tissues and 18 cases of nasopharyngeal carcinoma tissues, extract total RNA with Trizol (product of Invitrogen Company), reverse transcribe 2 μg RNA into cDNA with miScript reverse transcription kit (product of Qiagen Company), and use QuantiTectSYBRGreenPCR kit (Qiagen company product) Real-time fluorescent quantitative PCR was used to detect the expression of BART6-3p and internal reference gene RNU6B. The public primers (UniversalPrimer) of microRNA and the specific primers of BART6-3p and RNU6B were all designed and synthesized by Qiagen.

[0075] Real-time fluorescence quantitative PCR reaction system

[0076]

[0077]

[0078] Real-time fluorescent quantitative PCR reaction steps

[0079]

[0080] After the reaction was comp...

Embodiment 2

[0083] Example 2, in situ hybridization detection found that the expression of BART6-3p in nasopharyngeal carcinoma and gastric carcinoma is related to the prognosis of patients

[0084] 1. Material method

[0085] 1.1 Design and synthesis of hybridization probes

[0086] In order to detect the expression of BART6-3p by in situ hybridization, we designed an oligonucleotide probe for detecting the expression of BART6-3p by in situ hybridization and a positive control in situ hybridization oligonucleotide probe.

[0087] BART6-3p probe: UCUAAGGCUAGUCCGAUCCCCG

[0088] Positive control probe (to detect the housekeeping gene GAPDH):

[0089] GAPDH probe: CAGUAGAGGCAGGGAUGAUGUUCU

[0090] The gene-specific oligonucleotide probe sequences designed above were synthesized by chemical synthesis method, and uracil in the probe sequences was labeled with biotin (bio-U) during the synthesis process.

[0091] 1.2 Oligonucleotide probe labeling kit and in situ hybridization detection re...

Embodiment 3

[0157] Example 3, Overexpression of BART6-3p inhibits growth, proliferation, invasion and metastasis of tumor cells

[0158] 1. Material method

[0159] 1.1 Cell culture and transfection

[0160] EBV-negative nasopharyngeal carcinoma cell lines 5-8F, HNE2, and gastric cancer cell AGS were purchased from the Cell Center of Central South University. The RPMI1640 medium and fetal bovine serum used for cell culture, and the trypsin used for digesting cells were all products of Gibco, USA.

[0161] BART6-3p is synthesized by Invitrogen Company through chemical synthesis, and the sequence is:

[0162] CGGGGAUCGGACUAGCCUUAGA

[0163] Tumor cell lines with good growth status were divided into 2×10 5 Cells / well were seeded in a 6-well plate, and the 6-well plate was placed at 37°C, 5% CO 2In the incubator, the transfection of BART6-3p can be started when the cells to be cultured grow to a density of 50-70%; the transfection process is as follows:

[0164] Add 8 μl of Hiperfect tra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a long-chain non-coding RNA (Ribose Nucleic Acid) gene LOC553103 to the preparation of nasopharyngeal darcinoma cell inhibitors. The RNA interference sequence of the LOC553103 is used for preparing a preparation for inhibiting the growth and the proliferation of nasopharyngeal darcinoma cells and preventing the tumor cell invasion migration, and is further used for preparing a preparation for inhibiting the framework assembly and reconstruction of the nasopharyngeal darcinoma cells. A powerful molecular biology tool is provided for the auxiliary treatment of the nasopharyngeal darcinoma, and profound clinical significance and important popularization and application prospects are realized.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and in particular relates to a method for preparing nasopharyngeal carcinoma cell inhibitors by using long-chain non-coding RNA gene LOC553103. Background technique [0002] Epstein-Barrvirus (EBV) is a ubiquitous human herpes virus that can infect about 95% of the adult population in the world. Except for a small number of people who occasionally cause infectious mononucleosis, most of the infected people There will not be any clinical symptoms, and EBV can remain latent in the host for a long time in most cases. However, latently infected EBV can lead to malignant tumors in some cases, including B-cell-derived Burkitt and Hodgkin's lymphoma, and epithelial-derived nasopharyngeal and gastric carcinomas. The mechanism of EBV leading to malignant tumors is not yet fully understood. It may be related to the expression of a series of genes encoded by EBV itself. For example, latent membrane p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61P35/00A61P35/04
Inventor 曾朝阳李桂源熊炜何宝玉李小玲李夏雨张文玲石磊龚朝建孛昊唐艳艳杨丽婷
Owner CENT SOUTH UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More