Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cattle muscle enhanser and application thereof

A technology of bovine muscle and subsequence, applied in bovine muscle enhancer and its application field, can solve the problem of reducing the safety of transgenic cattle and achieve the effect of enhancing transcriptional activity

Active Publication Date: 2015-12-30
CHINA AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] When preparing transgenic cattle and constructing gene overexpression vectors, it is often necessary to add enhancer sequences to the vector to increase the expression of foreign genes in cattle. However, most of the enhancers currently used are mouse sequences, and there are no bovine own sequences. sequence, reducing the safety of genetically modified cattle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cattle muscle enhanser and application thereof
  • Cattle muscle enhanser and application thereof
  • Cattle muscle enhanser and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 PCR amplification bovine muscle enhancer sequence

[0036] Genomic DNA of Angus cattle was extracted and used as a template (concentration: 80ng / ul); PCR amplification was performed with Q5 ultra-high-fidelity DNA polymerase (NEB, M0491L) and specific amplification primers to obtain beef muscle enhancement Subsequence (its nucleotide sequence is shown in SEQ ID No.1).

[0037] The PCR amplification program is shown in Table 1, and the PCR reaction system is shown in Table 2.

[0038] The specific amplification primer pair is as follows:

[0039] Upstream primer sequence (containing BamHI restriction site and protective base): ATCGGGATCCGCCAAGATAAGGTTGGGACA;

[0040] Downstream primer sequence (containing SalI restriction site and protection base): ATCGGTCGACTTTAAAACCCCCTCACCCTTC.

[0041] Table 1 PCR amplification program

[0042]

[0043] Table 2 PCR reaction system

[0044]

Embodiment 2

[0045] Example 2 Construction of the PGL3 luciferase reporter carrier containing the enhancer sequence of the present invention

[0046] 1) Digest the enhancer sequence amplified in Example 1 and the pGL3-promoter vector (PromegaE1761) with BamHI and SalI restriction endonucleases;

[0047] 2) After electrophoresis, cut the gel to recover the digested product;

[0048] 3) The enhancer sequence and the vector were ligated overnight at 4°C with T4 ligase (NEBM0202L);

[0049] 4) Use the ligated product to transform Escherichia coli, and after plating, incubate upside down at 37°C for about 12 hours;

[0050] 5) Pick a single clone, streak it on an LB culture plate, incubate it upside down at 37°C for 8 hours, and carry out bacterial cell PCR identification. Detection of amplification results by PCR and agarose electrophoresis;

[0051] 6) Perform DNA sequencing on PCR-positive colonies;

[0052] 7) Transfer the expected colonies to LB medium and culture them on a shaker at 3...

Embodiment 3

[0054] Example 3 Functional Verification of Bovine Muscle Enhancer

[0055] 1. When the confluence of C2C12 cells is 60%-70%, use liposome 2000 (11668-019, Invitrogen) to co-transform pGL3-1357 and pRL-TK (E2241), pGL3-promoter and For pRL-TK, when the confluence of the cells reaches 90%, the cells are cultured with a differentiation medium, and the cells are induced to differentiate for 6 days.

[0056] The differentiation medium is DMEM high glucose medium containing 2% horse serum and 1% penicillin / streptomycin.

[0057] The conditions for culturing with differentiation medium were: 37°C, 5% CO2.

[0058] 2. Use after 6 days of differentiation The Luciferase assay (PromegaE2920) kit detects firefly luciferase and sea cucumber luciferase, and uses the ratio of firefly luciferase / sea cucumber luciferase to illustrate whether the enhancer works, such as figure 1 As shown, the enhancer discovered in the present invention has about 11-fold enhancement effect.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology, and particularly discloses a cattle muscle enhanser and application thereof. A nucleotide sequence of the cattle muscle enhanser is shown as SEQ ID No.1 (in the description). The cattle muscle enhanser can specifically enhance the transcriptional activity of a promoter in a myoblast remarkably.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a bovine muscle enhancer and its application. Background technique [0002] In 1978, Reddy et al. first discovered that there was an enhancer sequence in the simian virus genome. In 1981, Banerji et al. found that this sequence is a necessary regulatory sequence for the survival and reproduction of the virus, and has a significant effect of enhancing gene transcription. Therefore, called "enhancers". [0003] The first eukaryotic enhancer was first discovered by Grosschedl and Birnstiel. In the regulation of eukaryotic gene expression, enhancers are very important cis-acting elements, which cooperate with promoters and play an important role in regulating the expression of eukaryotic genes. Enhancers generally consist of two or more enhancer elements, which can enhance transcription. Enhancers have two major characteristics: (1) no directionality, that is, no matter whether the en...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11C12N15/85C12N15/66
Inventor 孟庆勇王萌畅雯
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com