Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of inulinase mutant and its application

A technology of inulinase and mutant, applied in the field of genetic engineering of enzymes, can solve the problems of incomplete reaction, high production cost, complicated process and the like

Active Publication Date: 2018-05-08
福建福大百特生物科技有限公司
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Enzymatic conversion of sucrose industrial large-scale synthesis of fructo-oligosaccharides, the by-product of the reaction glucose is an enzyme inhibitor, the reaction is not complete, the mixture contains a large amount of glucose and sucrose, the total amount of fructo-oligosaccharides is ≤55% to 60% % (dry basis), and the process is complicated and the production cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of inulinase mutant and its application
  • A kind of inulinase mutant and its application
  • A kind of inulinase mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1: Cloning and codon optimization of inuI gene

[0050] Construction of recombinant plasmid: Total RNA of Aspergillus niger NRRL3135 was extracted with TRNzol total RNA extraction reagent. Using total RNA as a template, refer to the instructions of the RT-PCR kit, use oligo(dT) as a primer to reverse transcribe the first-strand cDNA, and then use the first-strand cDNA as a template to use primers F1 (SEQ ID NO: 6) and R1 (SEQ ID NO: 7) was used to amplify the Aspergillus niger inulinase gene inuI by PCR. The PCR product and plasmid pPIC9K were digested with EcoR I and Not I, purified, ligated, and transformed into Escherichia coli JM109 competent cells. Positive transformants were screened, and their plasmids were extracted for enzyme digestion verification. The correct recombinant plasmid verified by enzyme digestion was then sequenced (sequence SEQ ID NO: 1), and the correct recombinant plasmid constructed was named pPIC9K-inuI.

[0051] Codon optimizati...

Embodiment 2

[0052] Example 2: Construction of Aspergillus niger inulinase mutation library using error-prone PCR method

[0053] The nucleotide mutation ( figure 1 ). The reaction conditions for error-prone PCR are as follows:

[0054]

[0055]

[0056] Wherein, primers F2 (SEQ ID NO:8) and R2 (SEQ ID NO:9) sequences (5'-3') are respectively:

[0057] Upstream primer F2: CCG GAATTC CAGTCTAATGATTACCGTCCTTCATAC

[0058] Downstream primer R2: ATAAGAAT GCGGCCGC TCATTCAAGTGAAACACTCCGC

[0059] PCR amplification conditions: 94°C for 3min; 94°C for 1min, 58°C for 1min, 72°C for 1.5min, 30 cycles; 72°C for 10min.

[0060] After the error-prone PCR amplification product is purified by DNA purification and recovery kit, it is digested with restriction endonucleases EcoR I and Not I, and connected with the corresponding digested plasmid pPIC9K, and transformed into E.coli JM109 Competent cells were spread on LB solid medium plates containing 100 μg / mL ampicillin. After culturing at ...

Embodiment 3

[0063] Example 3: Screening of High Enzyme Activity Inulinase Mutants

[0064] Use a sterilized toothpick to remove the His grown on the MD plate + The transformant is copied to the same position of the YPD and the BMMYI plate, and the control bacteria GS115 / pPIC9K-inuI' (without error-prone PCR, the preparation process is the same as the product of Example 2) is inoculated on the BMMYI plate. Incubate at 30°C for 2 days, and save the grown YPD plate.

[0065] Plate primary screening: Induce the mutant strains on the BMMYI plate for 2-3 days. The strain with the transparent circle around the bacterium colony on the plate larger than the control bacterium GS115 / pPIC9K-inuI' is the mutant strain of the primary screening purpose.

[0066] 96-well plate re-screening: Add 300 μL of BMGY medium to a 1.8 mL / well (flat-bottomed) 96-well plate, and sterilize at 121° C. for 20 minutes. Into it, insert the primary screening target strain preserved on the YPD plate (simultaneously inse...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an inulase mutant and a preparing method. According to the inulase mutant and the preparing method, directed evolution is carried out on an encoding gene inuI of inulase in vitro with a codon optimization technology, an error-prone PCR technology and a site-directed mutagenesis technology, and the mutant with the inulase activity remarkably improved is screened out. The K<cat> value of the mutant is 3.1 times that of the inulase of an original strain; in addition, the preparing process of the inulase is easy to implement and high in enzyme production efficiency, and the enzyme activity of fermentation liquor in a 30-m<3> system can be 60,000 U / ml. Meanwhile, the invention discloses a DNA sequence, an expression vector and a host cell of the encoding inulase mutant. According to the inulase mutant, the preparing method and the DNA sequence, the expression vector and the host cell of the encoding inulase mutant, high efficiency and simple and convenient operability are achieved.

Description

Technical field: [0001] The invention belongs to the technical field of enzyme genetic engineering, and in particular relates to an inulinase and a preparation method thereof. Background technique: [0002] Fructooligosaccharides, referred to as FOS, also known as oligofructose or saccharotriose oligosaccharides, molecular formula: G-F-Fn, n=1~3 (G is glucose, F is fructose). It is a linear oligosaccharide composed of β-D-fructosyl linked by β-2,1 glycosidic bonds. At present, there are two methods for producing fructooligosaccharides in industry, fructooligosaccharides synthesized by enzymatic conversion of sucrose and whole fructooligosaccharides obtained by partial hydrolysis of inulin. The two are slightly different in structure, but their physiological functions are basically the same. Both have many beneficial functions to the human body, such as low calorie, promoting mineral absorption, not causing dental caries, lowering blood fat, laxative, is a proliferation fac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/24C12N15/56C12N15/81C12N1/19C12N15/10
CPCC12N9/2402C12Y302/01007
Inventor 牛丹丹叶秀云
Owner 福建福大百特生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com