Transgenic method based on RMCE technology
A transgenic and technological technology, applied in the field of genetic modification, can solve problems such as uncertain insertion position and copy number, gene silencing, and affecting genome expression, achieving the effects of short cycle, reduced toxicity, time and cost savings
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Introduction to the inserted gene: Human Cholinergic Receptor, Muscarinic4 (CHRM4) gene, Ensembl's gene number is ENSG00000180720, the gene coding region is 1437bp in length; it has various functions, such as participating in the inhibition of adenylate cyclase and the degradation of phosphoinositide. All DNA templates such as EF1α, eGFP gene, and CHRM4 gene in this example were synthesized by Suzhou Jinweizhi Gene Company.
[0051] (1) Construction of tool mouse
[0052] 1. Vector construction: add the Lox2272 site, EF1α, eGFP gene, LoxP site, Frt site, Neo and DTA termination regions to the backbone of the Rosa26 vector. Carrier skeleton such as Figure 21 .
[0053] 1) PCR amplification of the fragment:
[0054] Primers for introducing EF1α and Lox2272 sites:
[0055] mRosa26-EF1a-F / HpaI: GGCTCCGGTGCCCGTCAGT
[0056] mRosa26-EF1α-R / AsisI: TCACGACACCTGAAATGGAAG
[0057] Remarks: The bold part is the homology arm, and the gray part is the sequence of the Lo...
Embodiment 2
[0150] Insert gene introduction: human NQO1 gene, Ensembl's gene number is 14910, the gene coding region is 825bp in length; it encodes a reduced coenzyme / quinone oxidoreductase, also known as DT-lipoamide dehydrogenase (DT-diaphorase) , is a flavin enzyme, NQO1 is widely distributed in organs, but the highest level is in the liver, kidney, and gastrointestinal tract. NQO1 enzyme can be induced by various chemicals, such as polycyclic aromatic hydrocarbons, hydroquinone, acrylate, broccoli (cruciferous plant extract), etc. NQO1 enzyme belongs to phase II metabolic enzymes. Together with other phase I and phase II metabolic enzymes, it constitutes the metabolic network of exogenous toxic substances in vivo and plays an important role in the detoxification and metabolism of the body. Polymorphisms in NQO1 reduce the ability of the NQO1 enzyme to detoxify chemicals, increasing the risk of blood disorders.
[0151] All DNA templates such as CMV and eGFP genes in this example were...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com