Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Promoter from rice and application thereof

A technology of promoter and rice, applied in the fields of genetic engineering and rice breeding, can solve problems such as restricting the promotion and development of transgenic crops, achieve good application prospects, avoid unnecessary waste, and increase the effect of local expression.

Inactive Publication Date: 2015-10-21
SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
View PDF3 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] With the development of modern genetic engineering technology, many genetically modified plants including many food crops have been obtained, but food safety issues have restricted the promotion and development of genetically modified crops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter from rice and application thereof
  • Promoter from rice and application thereof
  • Promoter from rice and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Cloning of the promoter of the OsHDT702 gene

[0034] Using the japonica rice variety "Zhonghua 11" as the experimental material, genomic DNA was extracted by CTAB method.

[0035] According to the sequence of rice gene OsHDT702 (Genebank accession number: AK072845) known in NCBI, primers were designed from the 1776 bp sequence upstream of the initiation codon ATG, and PCR amplification was performed using genomic DNA as a template. The amplification primer is HDT702P-F: AT AAGCTT GTGCTCGTGCCGTCGTCCTT (the underlined part is the Hind III restriction site); HDT702P-R: AT CTGCAG TCTCCTCGCCGTGCTCCTCT (the underlined part is the restriction site of Pst I). The PCR reaction was carried out in a 50ul system, and the reaction parameters were: pre-denaturation at 94°C for 5min; denaturation at 94°C for 30s, annealing at 56°C for 45s, extension at 72°C for 2min, 35 cycles; extension at 72°C for 5min. The PCR amplified product was separated by 1.0% agarose gel ele...

Embodiment 2

[0037] Example 2: Analysis of cis-acting elements on HDT702P sequence

[0038] Put the HDT702P sequence on the PLACE promoter analysis website ( http: / / www.dna.affrc.go.jp / PLACE / ) on cis-acting element analysis. The result is as figure 2 As shown, the sequence of HDT702P contains multiple anther-specific expression cis-acting elements and various hormone-responsive elements.

Embodiment 3

[0039] Example 3: Obtaining and identification of rice transfected with PCAMBIA1391Z-HDT702P vector

[0040] 1. Construction of PCAMBIA1391Z-HDT702P vector

[0041] The positive clone that sequencing is correct among the embodiment 1 extracts plasmid, the plasmid of extracting and pcambia1391Z vector (its structure such as image 3 Shown) Digest with Hind III and Pst I at the same time, recover the target fragment, use T4 ligase to connect the target DNA fragment and the PCAMBIA1391Z vector digested with Hind III and Pst I, and you can get the GUS gene containing HDT702P and its downstream gene The expression vector PCAMBIA1391Z-HDT702P. There is a Sac I restriction site at about 900 bp upstream of the HDT702P fragment, but PCAMBIA1391Z does not have a Sac I restriction site, so a small fragment of 900 bp will be obtained by cutting the fusion vector with Hind III and Sac I to identify a positive plasmid; Figure 4 As shown, lanes 1, 3, 5, and 7 correspond to positive plasmi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an HDT702 promoter and application thereof. The HDT702 promoter is obtained from cloning of rice, and the nucleotide sequence of the HDT702 promoter is shown in SEQ ID NO.1. The promoter is a tissue specificity promoter and can promote the specific expression of downstream genes in anther of rice. The HDT702 promoter is applied into the transgenic engineering, so that an expression product of target genes is specifically accumulated in the anther, and the local expression amount is increased; and meanwhile, unnecessary waste of plant nutrients can be avoided, and therefore good application prospects can be achieved in the transgenic engineering.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering and rice breeding, and specifically relates to a promoter derived from rice and its application. Background technique [0002] Promoter refers to the region on a DNA molecule that can bind to RNA polymerase and form a transcription initiation complex, usually located upstream of the coding gene. There are a large number of cis-acting elements in the promoter fragment, and transcription factors regulate the transcription of genes by combining with cis-acting elements. Therefore, the isolation and functional analysis of promoters are important contents of genetic engineering research. [0003] Promoters commonly used in plant genetic engineering are divided into three categories according to their mode of action and function: constitutive, tissue-specific and inducible promoters. Constitutive promoters promote the expression of genes in various tissues of the plant, which are persisten...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/74C12N1/21
Inventor 段俊赵金会张建霞吴坤林曾宋君张新华
Owner SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com