Primers for detecting hot-spot mutation sites of KRAS gene, kit and PCR (polymerase chain reaction) method for primers or kit
A mutation site and kit technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of high detection cost, inability to detect clinical specimens on a large scale at the same time, and high price of detection instruments. Achieve the effect of increasing PCR differentiation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0121] Example 1: Preparation of wild-type and mutant-type positive plasmids directed at 7 hotspot mutations of the KRAS gene
[0122] The KRAS gene encodes a 21kDa KRAS protein, which plays an important regulatory role in the signal transduction pathways of tumor cell growth and angiogenesis. The most common mutations of the KRAS gene are point mutations, and the mutation sites are mainly in the 12th codon, 13th codon of exon 2 and the 61st codon of exon 3, which will lead to the prognosis of patients with colorectal cancer and lung cancer Poor, and resistant to targeted drugs—KRAS tyrosine kinase inhibitors and anti-KRAS antibodies. KRAS gene mutation detection has been included in the 2011 edition of the NCCN (National Comprehensive Cancer Network) Chinese version of the clinical practice guidelines for colorectal cancer and the 2011 edition of the clinical practice guidelines for non-small cell lung cancer to help doctors choose cancer treatments The most effective treatm...
Embodiment 2
[0153] Example 2: Design and specificity screening of allele-specific primers (ASP)
[0154] For Gly12Asp of the KRAS gene, wild-type and a series of mutant-specific primers were designed as follows:
[0155] 1. KRAS Gly12Asp-WT-F: aaacttgtggtagttggagcagt (SEQ No. 26)
[0156] 2. KRAS Gly12Asp-Mut-F: aaacttgtggtagttggagcaga (SEQ No. 27)
[0157] 3. KRAS Gly12Asp-Mut-F1: aacttgtggtagttggagcaga (SEQ No. 28)
[0158] 4. KRAS Gly12Asp-Mut-F2: acttgtggtagttggagcaga (SEQ No. 29)
[0159] 5. KRAS Gly12Asp-Mut-F3: aaacttgtggtagttggagctca (SEQ No. 30)
[0160] 6. KRAS Gly12Asp-Mut-F4: aacttgtggtagttggagctca (SEQ No. 31)
[0161] 7. KRAS Gly12Asp-Mut-F5: acttgtggtagttggagctca (SEQ No. 32)
[0162] At the same time, a specific Taqman probe was designed and synthesized: FAM-tgtggacgaatatgatccaacaatagagg-BHQ1 (SEQ No.33).
[0163] Relevant primers and probes were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.
[0164] Then use the above 7 primers to pair with the common d...
Embodiment 3
[0166] Embodiment 3: ASP sensitivity screening
[0167] Then use the No. 7 primer to pair with the KRAS Gly12Asp-R primer respectively, and use the mutant recombinant plasmid according to 10 6 、10 5 、10 4 、10 3 、10 2 , 10, and 0 for serial dilution, plus Taqman specific probes, for sensitivity verification on a fluorescent quantitative PCR instrument. No. 7 mutation-specific primer can detect 100 copies of the mutant, so this primer is the best primer for detecting the mutation site of the KRAS Gly12Asp gene screened according to our method, as shown in Table 3.
[0168] By analogy, we respectively designed and screened KRAS-Gly12Ala, Gly12Val, Gly12Ser, Gly12Arg, Gly12Cys and Gly13Asp mutation-specific primers, as shown in Table 3.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com