Cotton bollworm transport protein ABCC2 as well as coding gene and application thereof
A technology for transferring genes and transfer proteins, which is applied to the cotton bollworm transfer protein ABCC2 and its encoding gene and application fields
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Clone of the Abamectin Resistance Gene ABCC2 of Cotton Bollworm
[0021] According to the results of RNA sequence sequencing, the longest possible HaABCC2 gene fragment of cotton bollworm was spliced, and primers 5'RACE-R1: GTGAAGGAACATGAAGGCGTAGT and 5'RACE-R2: AGTTCAGCCCCAGCATGGCGAGA were designed to amplify the 5' fragment of HaABCC2 gene. Primers 3'RACE-F1: CAGTCCTGGTGTCTGGTGTTCA and 3'RACE-F2 were designed to amplify the 3' fragment of HaABCC2 gene. The 5' and 3' fragments were cloned and sequenced separately and assembled with known fragments to obtain a complete cDNA sequence. Primer HaABCC2F was designed according to the assembled cDNA sequence:
[0022] CTTCAGGAATTGCTCACATTAGG and HaABCC2R:
[0023] CTTTATGTAAACAATAAATTAGTATTAAA ORF amplification and clone sequencing verification. PCR reaction. Conditions: Preheating at 94°C for 4 minutes, denaturation at 94°C for 30s, annealing at 55°C for 30s, extension at 72°C for 3 minutes, a total of 35 cycle...
Embodiment 2
[0024] Example 2 Abamectin resistance gene ABCC2 of cotton bollworm reduces the defense ability of target pests to biological pesticides
[0025] Design primer ABCC2RNAiF containing T7 promoter
[0026] 5' TAATACGACTCACTATAG TGGGCGACTTTGGTGATTTG'3,
[0027] ABCC2 RNAiR 5' TAATACGACTCACTATA TTTGATGCTGCCGCTTATGT'3, ABCC2cDNA was used as a template to amplify the target fragment by PCR. The target fragment is recovered, and a large amount of dsRNA of the target gene is synthesized by using the dsRNA synthesis method in vitro as a template, and the dsRNA is incorporated into the feed of the cotton bollworm. When the cotton bollworm eats the feed, it will take the dsRNA of the target gene into the body together. The midguts were taken 24 hours, 72 hours and 120 hours after the cotton bollworm fed, respectively, to identify the expression level of the target gene. The detection found that the target gene of cotton bollworm feeding on dsRNA was down-regulated by about 50%. Th...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com