Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cotton bollworm transport protein ABCC2 as well as coding gene and application thereof

A technology for transferring genes and transfer proteins, which is applied to the cotton bollworm transfer protein ABCC2 and its encoding gene and application fields

Active Publication Date: 2015-08-26
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role of specific members of ABC transporters in specific insecticide resistance, especially the function of ABC transporter members in resistance to specific insecticides in cotton bollworm, is still poorly understood.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton bollworm transport protein ABCC2 as well as coding gene and application thereof
  • Cotton bollworm transport protein ABCC2 as well as coding gene and application thereof
  • Cotton bollworm transport protein ABCC2 as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Clone of the Abamectin Resistance Gene ABCC2 of Cotton Bollworm

[0021] According to the results of RNA sequence sequencing, the longest possible HaABCC2 gene fragment of cotton bollworm was spliced, and primers 5'RACE-R1: GTGAAGGAACATGAAGGCGTAGT and 5'RACE-R2: AGTTCAGCCCCAGCATGGCGAGA were designed to amplify the 5' fragment of HaABCC2 gene. Primers 3'RACE-F1: CAGTCCTGGTGTCTGGTGTTCA and 3'RACE-F2 were designed to amplify the 3' fragment of HaABCC2 gene. The 5' and 3' fragments were cloned and sequenced separately and assembled with known fragments to obtain a complete cDNA sequence. Primer HaABCC2F was designed according to the assembled cDNA sequence:

[0022] CTTCAGGAATTGCTCACATTAGG and HaABCC2R:

[0023] CTTTATGTAAACAATAAATTAGTATTAAA ORF amplification and clone sequencing verification. PCR reaction. Conditions: Preheating at 94°C for 4 minutes, denaturation at 94°C for 30s, annealing at 55°C for 30s, extension at 72°C for 3 minutes, a total of 35 cycle...

Embodiment 2

[0024] Example 2 Abamectin resistance gene ABCC2 of cotton bollworm reduces the defense ability of target pests to biological pesticides

[0025] Design primer ABCC2RNAiF containing T7 promoter

[0026] 5' TAATACGACTCACTATAG TGGGCGACTTTGGTGATTTG'3,

[0027] ABCC2 RNAiR 5' TAATACGACTCACTATA TTTGATGCTGCCGCTTATGT'3, ABCC2cDNA was used as a template to amplify the target fragment by PCR. The target fragment is recovered, and a large amount of dsRNA of the target gene is synthesized by using the dsRNA synthesis method in vitro as a template, and the dsRNA is incorporated into the feed of the cotton bollworm. When the cotton bollworm eats the feed, it will take the dsRNA of the target gene into the body together. The midguts were taken 24 hours, 72 hours and 120 hours after the cotton bollworm fed, respectively, to identify the expression level of the target gene. The detection found that the target gene of cotton bollworm feeding on dsRNA was down-regulated by about 50%. Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of genetic engineering, and in particular relates to a cotton bollworm transport protein ABCC2 as well as a coding gene and an application thereof. The nucleotide sequence of the gene ABCC2 is shown in the SEQ ID No.2. In the invention, cotton bollworm transport protein ABCC2 is obtained through cloning, and the effect of a pesticide is enhanced by lowering the defense capability of target pests on biopesticide, so as to combine the biopesticide control with an insect gene silencing technology, open up a new field of pest control, and have important significance in lowering use amount of biopesticide, enhancing the pest control effect, improving food safety and increasing environment protection.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the cotton bollworm transport protein ABCC2 and its coding gene and application. Background technique [0002] Cotton bollworm is an important polyphagous agricultural pest, which feeds on a variety of food and vegetable crops such as cotton, corn, soybean, wheat, eggplant, tomato, and pepper. Abamectin is an important biological agent for the control of cotton bollworm. It is currently used in large quantities. The resistance of cotton bollworm to abamectin leads to a decline in the control effect of abamectin. [0003] The ABC transporter family has many members, and the ABC transporter of eukaryotes has the function of transporting small molecule chemical substances from intracellular to extracellular, so as to achieve the function of defense against small molecular compounds such as biopesticides. For example, Drosophila (Dipoena melanogaster) has been reported that the re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/87A01K67/033
CPCA01K67/0339C07K14/43563C12N15/87
Inventor 肖玉涛张丹丹胡朝兴吴孔明
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com