Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Artificially synthesized DNA storage medium with coding information, storage reading method for information, and applications

A technology of artificial synthesis and storage medium, applied in the fields of molecular biology and DNA storage, it can solve the problems of long coding sequence, increase decoding difficulty and error rate, etc., and achieve the effect of wide application range and low sequencing cost.

Active Publication Date: 2015-08-19
SUZHOU HONGXUN BIOTECH CO LTD
View PDF2 Cites 44 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Sixth, the current cost of DNA storage technology may be cheaper than traditional tape storage
[0007] The above-mentioned digital information storage using binary code and ternary code is universal. Any digital information can be encoded into the form of 0 and 1. They are based on the direct encoding method of 0 and 1, but based on binary code and ternary code. The code sequence of the digital information storage system of the code is relatively long, which objectively increases the difficulty of decoding and the error rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificially synthesized DNA storage medium with coding information, storage reading method for information, and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Steps for storing and extracting the English digitized information "www.synbio-tech.com".

[0035] Convert the digitized information consisting of English and punctuation marks into a base sequence according to the index table Table 1;

[0036] For example, w corresponds to TAGT, s corresponds to TATG, etc., which are coded sequentially, and the full code sequence is TAGTTAGTTAGTAATCTATGTCATTTACTCAGTTCCTTAGACACTCTATGCATCGATTGGAATCTCGATTAGTGTG;

[0037] Add the start codon GTTG and the stop codon TAAT before and after the whole sequence, and the resulting sequence is GTTGTAGTTAGTTAGTAATCTATGTCATTTACTCAGTTCCTTAGACACTCTATGCATCGATTGGAATCTCGATTAGTGTGTAAT;

[0038] That is to complete the conversion of English digital information to DNA sequence;

[0039] Then use the oligonucleotide synthesizer to synthesize artificial DNA according to the base sequence obtained above;

[0040] Thus, the writing of the digital information was completed, and the DNA sequence with the digita...

Embodiment 2

[0044] The steps of storing and extracting Chinese digital information "synthesis leads innovation".

[0045] Convert "synthesis leading innovation" into Unicode. For example, the Unicode corresponding to "combination" is u5408, and the Unicode corresponding to "cheng" is u6210. The full sequence of encoded Unicode is as follows: u5408u6210u5f15u9886u521bu65b0;

[0046] Convert it into a base sequence according to the index table Table 1. For example, u corresponds to TGTA, 5 corresponds to AGAT, etc., and encode them in order. The full sequence of the encoding is as follows:

[0047] TGTAAGATACATAAGTACTATGTAATCAATACAATGAAGTTGTAAGATTTCGAATGAGATTGTAAGTAACTAACTAATCATGTAAGATACAATGTCAGTGTAATCAAGATTCAGAAGT,

[0048] Add the start codon GTTG and the stop codon TAAT before and after the whole sequence, and the resulting sequence is TTGTGTAAGATACATAAGTACTATGTAATCAATACAATGAAGTTGTAAGATTTCGAATGAGATTGTAAGTAACTAACTAATCATGTAAGATATACAATGTCAGTGTAATCAAGATTCAGAAGTTAAT;

[0049] That is to comp...

Embodiment 3

[0057] Application of DNA storage media with encoded information in watermarking.

[0058] In this example, we converted a piece of English digitized information into encoded information stored in DNA, and recombined it with the carrier to be marked to form a carrier sequence with a specific English digitized information as a watermark.

[0059] According to the method in Example 1, "Innovation through Synthesis" was converted into a DNA base sequence: CCAATTACTTACTTAGTACTTAGCTCTATTCCTAGTTACATCGTCTATTGGTATCTTAGTGTATTGCTTGGATCGGTCATCATTTACTCTATTGGTGCATATGTTCCTATG; the start codon GTTG and the stop codon TAAT were added to the beginning and end of this sequence, respectively, and the full sequence obtained is as follows: GTTG CCAATTACTTACTTAGTACTTAGCTCTATTCCTTAGTTACATCGTCTATTGGTATCTTAGTGTATTGCTTGGATCGGTCATCATTTACTCTATTGGTGCATATGTTCCTATG TAAT ;

[0060] Use the base sequence obtained above to synthesize artificial DNA with an oligonucleotide synthesizer, and then recombine it i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology, specifically belongs to the technical field of DNA storage, more specifically an artificially synthesized DNA storage medium with coding information, a storage reading method for the information, and applications. Discarding DNA storage technology depended on a mature binary code or a ternary code in the prior art, the invention creatively discloses a DNA storage mode capable of coding directly. Through using storage method capable of coding directly, especially tetragenous basic group coding, the obtained DNA chain storing digit information is short in entire sequence and average content of guanine and cytosine in the sequence is relatively balanced. The method of the invention is in favour of synthesizing, convenient for decoding, and could reduce error rate. The method of the invention can be used for covering a plurality of character types such as English, figure, Chinese and punctuation marks with wide application range.

Description

technical field [0001] The invention belongs to the field of molecular biology, in particular to the technical field of DNA storage, and more specifically relates to a DNA storage medium with coded information and a method for storing and reading information. Background technique [0002] Since the beginning of the 21st century, human development has entered an information society from an industrialized society. The role of information technology and information industry in economic and social development has been increasingly strengthened. The proportion of information industry in the national economy and the degree of application of information technology in traditional industries And the level of information infrastructure construction has been continuously improved. Digital information has been widely used in people's life, industry, scientific research and other fields, and digital information storage technology has gradually developed accordingly. Data storage techn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G06F19/16
Inventor 杨平孙德斌柳伟强齐金才陈文柱刁文一唐四东
Owner SUZHOU HONGXUN BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com