Ub-Nanoluc reporter gene system and Ub-Ub-GS-Nanoluc reporter gene system, constructions and applications thereof
A ub-ub-gs-nanoluc, reporter gene technology, applied in the field of flux screening of deubiquitinase inhibitors or agonists, can solve the problems of false positives, difficult to obtain, high cost and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] Embodiment 1 obtains Ub-Nanoluc reporter gene and protein of the present invention
[0082] Molecular Cloning
[0083] The pET-28a and pCDNA3.1Ub constructed by molecular cloning were preserved by our laboratory, and the PNL1.1 plasmid was obtained from Promega Company.
[0084] Primers for PCR amplification of full-length Ub gene:
[0085] Sense strand: 5'ggatccatgcagatcttcgtgaaaac3' (SEQ ID NO.8); restriction site BamHI
[0086] Antisense strand: 5'ctgcgtctgagaggtggtatggaattc3' (SEQ ID NO.9); restriction site EcoRIPCR amplification full-length Nanoluc gene primer:
[0087] Sense strand: 5'gaattcatggtcttcacactcgaagatt3' (SEQ ID NO.10); enzyme cutting site EcoRI
[0088] Antisense strand: 5'gtgcgaacgcattctggcgtactcgag3' (SEQ ID NO.11); restriction site XhoIPCR reaction system
[0089]
[0090] PCR reaction conditions
[0091]
[0092] After the PCR reaction is completed, use the Tiangen Gel Recovery Kit to recover the PCR fragments
[0093] Digest with Takara...
Embodiment 2
[0163] Embodiment 2 constructs polyclonal antibody
[0164] Construction of prokaryotic Nanoluc expression clones and purification of GST-Nanoluc protein (refer to Example 1 for experimental methods)
[0165] Polyclonal Antibody Preparation
[0166] Immune animals: two New Zealand rabbits
[0167] Adjuvant: Complete Freund's adjuvant was used first, followed by incomplete Freund's adjuvant.
[0168]Immunogen: GST-Nanoluc. 500 μg of immunogen per immunization.
[0169] Immunization: Dilute the immunogen with phosphate buffer, and then mix it with the corresponding adjuvant 1:1. The antigen and adjuvant are completely mixed to form a stable emulsion. The emulsion is injected subcutaneously under the skin around the shoulders of the rabbit and intramuscularly injected into the hind thigh , about 1 / 4 of the immunogen is used in each area, so that the immunogen can persist and improve the immune response.
[0170] Blood collection: Use a 19-gauge needle to collect blood from t...
Embodiment 3
[0180] Example 3 Deubiquitinating enzyme USP15 hydrolyzes the isopeptide tendon between ubiquitin and Nanoluc luciferase and detects protein levels by Western Blot
[0181] (1) The deubiquitinating enzyme USP15 hydrolyzes the isopeptide tendon between ubiquitin and Nanoluc luciferase:
[0182] Incubate the deubiquitinating enzyme USP15 protein and Ub-Nanoluc protein molecules in the reaction system at 30°C for half an hour
[0183] (2) Detection of protein level by Western Blot:
[0184] The basic principle of Western Blot is antigen-antibody reaction. Proteins were separated by polyacrylamide gel electrophoresis and transferred to a solid support (nitrocellulose membrane was used in this experiment). React with a specific primary antibody, and then react with a fluorescent secondary antibody to develop color, and the immunoblot image of the specific protein molecule can be obtained. This method has the characteristic of detecting specific antigens from mixed antigens.
[...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap