Aptamer capable of being in specific binding to TS/MDEP protein in gastric cancer cells
A gastric cancer and protein technology, applied in the direction of recombinant DNA technology, DNA / RNA fragments, material inspection products, etc., can solve the problem of expression reduction and achieve the effect of simple method and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment I
[0022] The SELEX screening of embodiment 1 TS / MDEP protein specific binding DNA adapter
[0023] The conventional TS / MDEP protein expression method in the art was adopted. According to the known gene sequence, the corresponding gene sequence was obtained by conventional gene synthesis or genome retrieval, and the TS / MDEP protein was expressed in vitro by yeast expression method, and the corresponding protein was obtained, which was named TS / MDEP.
[0024] Chemically synthesize the initial oligonucleotide random library and primers, the sequence is as follows: (5'-GGTAACTAGCGTTACTGCTAG----N38----TGCATAAGGCATCATTGGAA-3'), wherein N38 is 38 random oligonucleotides;
[0025] Primer P1: GGTAACTAGCGTTACTGCTAG;
[0026] Primer P2: TTCCAATGATGCCTTATGCA.
[0027] The single-stranded DNA library was amplified into double-stranded DNA, and the product was subjected to 2% agarose gel electrophoresis and then gel-cut to recover and purify; the recovered double-stranded DNA was used as ...
Embodiment 2
[0028] Example 2 Obtainment of TS / MDEP-binding gametes with high specificity and high affinity
[0029] name Dissociation constant Kd TS-002 22nM TS-005 27nM TS-006 25nM TS-013 29nM TS-014 33nM TS-015 21nM TS-017 19nM TS-019 28nM TS-024 27nM TS-026 22nM TS-028 33nM TS-030 32nM PBS blank control no binding ability
Embodiment 3
[0030] Example 3 The aptamer specificity analysis and stability analysis
[0031] Human albumin, RASAL1 protein, YAP protein, TRIM59 protein and 12 aptamers were used for specific detection. After binding experiments, it was found that these aptamers did not bind to these proteins, but only combined with TS / MDEP maintain high specificity.
[0032] 0.1 ug of the aptamer was taken and placed in normal temperature serum and aqueous solution for two weeks. Through RT-PCR detection, it was found that its structure was stable and not degraded after two weeks of placement.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com