Molecular marker for rice aroma gene and application thereof
A fragrance gene and molecular marker technology, applied in the field of plant biology, can solve the problem of less obvious polymorphism differences, and achieve the effects of improving breeding efficiency, strong specificity, and moderate marker amplification fragments.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Rice badh2-E7 Primer design for the allelic functional marker badh2-E7-FM
[0033] 1. Primer design
[0034] Aroma gene in rice badh2 Comparing the sequences of scented and non-scented alleles in different rice varieties, it was analyzed that there was an 8bp deletion and 3bp variation in exon 7 of the coding region, and a functional marker covering the difference was designed badh2 - E7 -FM ( figure 1 ). said badh2 - E7 -FM consists of 4 primers Badh2-WT-F, Badh2-E7-R, Badh2-O-F and Badh2-O-R, and the primer sequences (5'-3') are as follows:
[0035] Badh2-WT-F: GGGAGTTATGAAACTGGTAAAAAGA
[0036] Badh2-E7-R: aaccataggagcagctgaaata
[0037] Badh2-O-F: cttccttcaggtgtgctaaaca
[0038] Badh2-O-R: GAATGATGCTCCAAAGTGTCTTGA
[0039] (The framed bases in the primer sequence are allelic variant bases)
[0040] 2. Analysis of expected amplified fragments
[0041] Using the above four primers for rice badh2 Genes were amplified, with aroma allele...
Embodiment 2
[0042] Example 2 uses badh2-E7 -FM Molecular Marker Identification of Aroma Genotypes in Five Rice Varieties
[0043] 1. Extraction of rice genomic DNA
[0044] Five rice varieties were used as materials: Huazhan / Basmati370, Huazhan, Nipponbare, Basmati370 and Ivory Xiangzhan. Select the young leaves of a single rice plant, and use the CTAB method to extract rice genomic DNA. The specific steps are as follows: (1) Take an appropriate amount of fresh leaves and put them in a 2 mL centrifuge tube and add liquid nitrogen to mash them. Add 1 mL of CTAB extract to the centrifuge tube. , shake well; (2) Place in a water bath or incubator at 65°C, shake gently every 10 minutes, take it out after 30-45 minutes; (3) After cooling for 2 minutes, add chloroform-isoamyl alcohol (24:1 ) until the tube is full, shake vigorously up and down to mix the two evenly; (4) put the centrifuge tube into a centrifuge at 15,000 r / min for 10 min and take it out; (5) carefully pipette the supernata...
Embodiment 3
[0054] Example 3 Application of badh2-E7-FM to identify individual rice plants
[0055] 1. Testing materials: Using the rice variety Huazhan as the reincarnation parent and Basmati370 as the donor parent, use backcrossing technology to introduce aroma genes into the Huazhan genetic background, backcross BC 1 f 2 10 individual plants of rice were used as test materials.
[0056] 2. Extraction of rice genomic DNA: same as Example 2.
[0057] 3. Functional mark badh2-E7 -FM amplification: same as Example 2.
[0058] 4. Polyacrylamide gel electrophoresis detection and genotype determination of the amplified product: same as Example 2, the results are as follows:
[0059] The amplified products are two fragments of 368 bp and 188 bp, showing that the genotype of the marker individual is the non-scent allele ( Badh2 - WT homozygous, figure 2 The 6th to 11th and 14th detection samples in the sample); the amplified products were three fragments of 360 bp (368 bp existed ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com