Cloning and identification of GhDUF231L1 gene related with cotton fiber development

A gene and gene coding technology, applied in genetic engineering, plant genetic improvement, fermentation, etc., can solve the problem that the function of family members needs to be explored.

Inactive Publication Date: 2015-06-17
HUAZHONG NORMAL UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above studies show that the known members of the DUF231 family in Arabidopsis are all involved in the synthesis and modification of secondary wall substances, and the functions of a large number of members of this family have yet to be explored.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning and identification of GhDUF231L1 gene related with cotton fiber development
  • Cloning and identification of GhDUF231L1 gene related with cotton fiber development
  • Cloning and identification of GhDUF231L1 gene related with cotton fiber development

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] The present invention is further illustrated by the following drawings and embodiments, but does not limit the scope of the present invention.

[0028] Cloning identification and functional analysis of the full-length sequence of a cotton DUF231 family member GhDUF231L1 gene:

[0029] 1. Isolation and identification of GhDUF231L1 gene sequence and its cDNA sequence

[0030] The cotton genome public database was screened by bioinformatics method, and the GhDUF231L1 gene sequence was analyzed and identified. Cotton genomic DNA was extracted, specific primers GhDUF231L1OE-up (CTTTCTAGAATGAGCTTTGCGGCATCTCCT) and GhDUF231L1OE-dn (CTTCTCGAGCTACAAATGTGCCAAAAATATTC) were designed, and the GhDUF231L1 gene was isolated and cloned by PCR. Cotton fiber RNA 20 days after flowering (20DPA) was extracted, reverse-transcribed into cDNA, and the full-length cDNA sequence of GhDUF231L1 was isolated and cloned by PCR. They were verified by DNA sequencing. The DNA sequence of the GhDUF2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a full-length sequence of a new cotton fiber specific expression gene GhDUF231L1, of which a function relates to formation and modification of cotton fiber secondary wall materials. The GhDUF231L1 gene comprises five exons and four introns as well as a 1.6kb promoter fragment and an encoded 430 amino acid. The gene is a cotton fiber secondary wall development specific gene, of which the expression quantity is rapidly increased in fibers after flowering for 15 days and the expression quantity reaches a peak value after the flowering for 20 days. The GhDUF231L1 promoter mainly expresses in a vascular system of leaf veins and stems of transgenic arabidopsis thaliana leaves and also expresses in roots, flowers and legumes; a promoter area contains a cis-acting element which can be bonded with upstream transcription factors. Transgenic plants are enlarged, the cellulose content is increased and the contents of cell wall monosaccharide compositions are changed because GhDUF231L1 is over-expressed in arabidopsis thaliana. The results prove that GhDUF231L1 participates in plant growth, in particular to the biological synthesis of secondary cell walls, so that GhDUF231L1 possibly plays a key role in cotton fiber development.

Description

Technical field: [0001] The present invention relates to cotton genes. Specifically, the cloning and functional identification of a DUF231 family gene GhDUF231L1 and its promoter specifically expressed in cotton fibers. Background technique: [0002] Cotton fiber is one of the natural resources with the highest known cellulose purity and occupies an important position in the world textile industry. Although the appearance of synthetic fibers has greatly reduced the market share of cotton fibers, cotton fibers cannot be replaced because of their good air permeability, warmth retention, moisture absorption, and comfortable wearing. With the introduction of high-efficiency and rapid spinning technology, the enhancement of people's awareness of health care and the improvement of living standards, the requirements for cotton fiber quality are becoming more and more urgent. Fiber strength is an important indicator of raw cotton quality. The thickening period of the secondary wal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12Q1/68
Inventor 李学宝张杰邹丹鄢静秋
Owner HUAZHONG NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap