Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A detection method and kit for swine fever virus based on the fluorescence characteristics of g-quadruplex

A swine fever virus and fluorescence detection technology, applied in the field of genetic engineering, can solve problems such as high requirements for operators, obstacles to application, expensive reagents, etc., and achieve the effects of improving detection efficiency, easy operation, and fast detection speed

Inactive Publication Date: 2017-12-29
GUIZHOU DAXING AGRI SCI & TECH DEV CO LTD +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this diagnostic method has problems such as expensive reagents, easy contamination, high requirements for operators, and the need for expensive fluorescent quantitative PCR amplification instruments, etc., which seriously hinder its application at the grassroots level.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The test kit for swine fever virus detection based on G-quadruplex fluorescent properties, which consists of:

[0029] (1) NASBA reaction buffer includes: 40mM Tris-HCl, pH8.0; 70mM KCl; 20mM MgCl 2 ; 1 mM deoxyribonucleoside triphosphates (dNTPs); 1 mM ribonucleoside triphosphates (NTPs); 10 mM dithiothreitol; 10% dimethylsulfoxide (DMSO).

[0030] (2) NASBA forward primer and reverse primer include, 0.5 μM forward primer E2P7f: ACTATGAGCCCAGGGACAGCTACTT; 0.5 μM reverse primer E2P7T7r: GTCGACTAATACGACTCACTATAGGGTTCCCTATCAACACTACCTCACCC T.

[0031] (3) NASBA enzyme reaction solution includes: T7 RNA polymerase 60U; AMV reverse transcriptase 5U; RNase H 0.1U, 2μg of BSA.

[0032] (4) The composition of G-quadruplex fluorescence detection reaction buffer includes: 10mM 4-hydroxyethylpiperazineethanesulfonic acid, 200mM sodium chloride and 20mM potassium chloride; upstream probe 1μM and downstream probe 1 μM. Add sterile double distilled water to make up to 97 μl.

[003...

Embodiment 2

[0040] The test kit for swine fever virus detection based on G-quadruplex fluorescent properties, which consists of:

[0041] (1) NASBA reaction buffer includes: 30mM Tris-HCl, pH8.0; 80mM KCl; 10mM MgCl 2 ; 2mM deoxyribonucleoside triphosphates (dNTPs); 0.5mM ribonucleoside triphosphates (NTPs); 5mM dithiothreitol; 20% dimethylsulfoxide (DMSO).

[0042] (2) NASBA forward primer and reverse primer include, 0.5 μM forward primer E2P7f: ACTATGAGCCCAGGGACAGCTACTT; 0.5 μM reverse primer E2P7T7r: GTCGACTAATACGACTCACTATAGGGTTCCCTATCAACACTACCTCACCC T.

[0043] (3) NASBA enzyme reaction solution includes: 40 U of T7 RNA polymerase; 2 U of AMV reverse transcriptase; 0.15 U of RNase H, 5 μg of BSA.

[0044] (4) The composition of G-quadruplex reaction buffer includes: 10mM 4-hydroxyethylpiperazineethanesulfonic acid, 200mM sodium chloride and 20mM potassium chloride; upstream probe 2μM and downstream probe 2μM, Add sterile double distilled water to make up to 97μl;

[0045] (5) The u...

Embodiment 3

[0052] The test kit for swine fever virus detection based on G-quadruplex fluorescent properties, which consists of:

[0053] (1) NASBA reaction buffer includes: 60mM Tris-HCl, pH8.0; 60mM KCl; 30mM MgCl 2 ; 0.5mM deoxyribonucleoside triphosphates (dNTPs); 2mM ribonucleoside triphosphates (NTPs); 20mM dithiothreitol; 5% dimethylsulfoxide (DMSO).

[0054] (2) NASBA forward primer and reverse primer include, 1 μM forward primer E2P7f: ACTATGAGCCCAGGGACAGCTACTT; 1 μM reverse primer E2P7T7r: GTCGACTAATACGACTCACTATAGGGTTCCTATCAACACTACCTCACCCT.

[0055] (3) NASBA enzyme reaction solution includes: T7 RNA polymerase 60U; AMV reverse transcriptase 5U; RNase H 0.05U, 0.5μg of BSA.

[0056] (4) The composition of G-quadruplex fluorescence detection reaction buffer includes: 10mM 4-hydroxyethylpiperazineethanesulfonic acid, 200mM sodium chloride and 20mM potassium chloride; upstream probe 0.5μM and downstream probe Needle 0.2 μM. Add sterile double distilled water to make up to 97 μl....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a swine fever virus detection method based on G-quadruplex fluorescence characteristic and a kit, and belongs to the technical field of gene engineering. The method comprises: utilizing a nucleic acid sequence-based amplification (NASBA) technology to amplify target RNA to obtain a single-chain RNA product; adding an upstream probe, a downstream probe and the RNA amplification product into a G- quadruplex fluorescence detection buffer, performing denaturation and annealing, then adding protoporphyrin, and utilizing a microplate reader or fluorophotometer to detect the fluorescence intensity in the reaction system, so as to determine whether the sample possesses a swine fever virus. The method is fast, precise and stable in swine fever virus detection speed, good in reappearance, simple in detection steps and low in cost.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a detection method for swine fever virus based on the fluorescence characteristics of G-quadruplex, and a kit used for the detection method for swine fever virus. Background technique [0002] Classical swine fever, also known as classical swine fever, is an acute or chronic, febrile and highly contagious infectious disease of pigs caused by swine fever virus (an RNA virus). Swine fever is distributed worldwide, seriously endangering the development of pig industry. Due to its high hazard, it is an international key quarantine object. In my country, the direct economic loss caused by swine fever reaches several billion yuan every year. At present, the detection methods for CSFV nucleic acid mainly include fluorescent quantitative RT-PCR method. However, this diagnostic method has problems such as expensive reagents, easy contamination, high requirements for operato...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/6865C12Q1/70C12Q2563/116C12Q2565/514
Inventor 王毅邓明刚鲁小璐
Owner GUIZHOU DAXING AGRI SCI & TECH DEV CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com