Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

The sgRNA that specifically recognizes porcine h11 locus and its coding dna and application

A technology for specific recognition and DNA molecules, applied in the field of sgRNA and its coding DNA, to achieve the effect of reducing off-target phenomenon and strong specificity

Active Publication Date: 2017-04-26
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Experiments confirm that there is no difference in growth and development between Hipp11-site-directed gene-modified mice and wild-type mice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The sgRNA that specifically recognizes porcine h11 locus and its coding dna and application
  • The sgRNA that specifically recognizes porcine h11 locus and its coding dna and application
  • The sgRNA that specifically recognizes porcine h11 locus and its coding dna and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Construction of sgRNA expression plasmid

[0023] 1. The H11 site sequence of the pig is called out in the gene bank, and its nucleotide sequence is shown in sequence 5 in the sequence table. The sgRNA target for gene knockout is selected according to the PAM sequence, and the PAM sequence is NGG:

[0024] sgRNA target site position 1 (named H11-sg1): GTTCCTGGAAGTTTAGATCAGGG, the nucleotide sequence that recognizes the target in the corresponding sgRNA sequence is shown in sequence 1 in the sequence listing; the DNA sequence encoding the above sequence is shown in the sequence listing Sequence 3 in.

[0025] sgRNA target site position 2 (named H11-sg2): AGATCAGGGTGGGCAGCTCTGGG, the corresponding sgRNA sequence recognizes the target nucleotide sequence as shown in sequence 2 in the sequence listing; the DNA sequence encoding the above sequence is shown in the sequence listing as shown in sequence 4.

[0026] 2. Construction of sgRNA expression plasmid

[002...

Embodiment 2

[0047] Example 2 Efficiency verification of sgRNA expression plasmid

[0048] 1. Isolation of porcine fetal fibroblasts

[0049] PEF cells were isolated from aborted pig fetuses. For specific isolation methods, please refer to the literature: Li Hong, Wei Hongjiang, Xu Chengsheng, Wang Xia, Qing Yubo, Zeng Yangzhi; biological characteristics.

[0050] 2. Nucleofection

[0051] 4 μg each of the recombinant plasmids Cas9 / gRNA-H11-sg1 and Cas9 / gRNA-H11-sg2 obtained in Example 1 were transfected into PEF cells by electroporation to obtain recombinant cells. The specific steps of transfection are as follows: use a nuclear transfer instrument (Amaxa, model: AAD-1001S) and a matching mammalian fibroblast transfection kit (Amaxa, product number: VPI-1002) for transfection. First, use 0.1% trypsin (Gibco, catalog number: 610-5300AG) to digest adherent cells, stop digestion with fetal bovine serum (Gibco, catalog number: 16000-044), and wash with phosphate buffer saline (Gibco, catalog...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides sgRNA specifically recognizing pig H11 site, and coding DNA and application of sgRNA. The sgRNA sequence comprises a fragment recognizing a specific DNA sequence on chromosome and a skeleton RNA fragment, the nucleotide sequence of the fragment recognizing the specific DNA sequence on chromosome is shown as 1) or 2): 1) a nucleotide sequence show as a sequence 1 or a sequence 2 in a sequence table; and 2) a nucleotide sequence which is obtained by substituting and / or deleting and / or adding one or more bases on the basis of the nucleotide sequence in 1) and possesses functions same to those of the nucleotide sequence in 1). The provided sgRNA is capable of efficiently recognizing pig H11 site, is capable of performing efficient site-specific cleavage by means of Cas9 enzyme, and establishes a solid basis for a subsequent efficient site-specific integration experiment aiming at pig H11 site.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to sgRNA capable of specifically recognizing pig H11 site, its coding DNA and application. Background technique [0002] In 2010, Simon Hippenmeyer of Stanford University and his research team isolated and identified a good gene insertion site on chromosome 11 of the mouse, named hipp11 site, or H11 site for short. The H11 site is located in the gap between the two genes Eif4enif1 and Drg1, adjacent to exon 19 of the Eif4enif1 gene and exon 9 of the Drg1 gene, with a size of about 5 kb. Because the H11 site is located between the two genes, it is relatively safe, has no gene silencing effect, and has a broad spectrum of cell expression activity. Experiments confirmed that the Hipp11 locus site-specific gene-modified mice had no difference in growth and development from wild-type mice. At present, there is a similar Ros26 site, but this site is a gene whose ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68C40B50/06
Inventor 李奎阮进学杨述林李和刚牟玉莲吴添文魏景亮徐奎黄雷周荣刘楠
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More