Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1

A rice, gene technology, applied in the field of plant genetic engineering and biology

Inactive Publication Date: 2015-03-11
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Existing research progress has found that there is a certain correlation between rice plant height and tiller number, and many genes that regulate these two traits exist in the same signaling pathway. Research on the relationship between plant height, tiller number and leaf shape Not yet reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1
  • Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1
  • Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Phenotypic analysis of wild type and mutants

[0040] Measure the plant height at the mature stage, the method is to measure with a ruler from the top of the ear to the bottom node; the number of tillers is the effective number of tillers at the mature stage; The value measured at the widest point of the spike blade. 25 individual plants were measured for each agronomic trait. The average value was calculated according to the measured values, and the P value was calculated by t test. The results are shown in Table 1.

[0041] The results showed that compared with the wild type, the mutant had a significantly reduced plant height, a significantly reduced number of tillers, and a significantly smaller length and width of flag leaves.

[0042] Table 1. Comparison of agronomic traits between wild type and mutants (2014, Beijing)

[0043]

[0044] Example: 2: PALS1 gene cloning

[0045] 1. pals1 Mutant source:

[0046] Rice ( Oryza sativa L. )mut...

Embodiment 3

[0060] Example 3: PALS1 transgene verification

[0061] 1. Construction of interference vectors

[0062] because PALS1 The full length of the genome is 13848 bp, and it is difficult to construct a complementary vector. Therefore, the inventors used the pLHRNAi interference carrier (authorized announcement number: CN102191262B; application number: 201110055864.X; invention name: an RNA interference carrier and its application) as a backbone to construct interference PALS1 Gene binary expression vectors for transgenic verification. The conserved sequence of the 346 bp gene in the CDS 1040-1385 interval of the PALS1 gene was selected as the specific interference region, and cDNA was used as the template for amplification. The primers for fragment amplification connected to the left multiple cloning site are: 5' TTCTGCACTAGGTACCAGGCCTGTTGATCGCATCCTAGGCTGTC 3' (1-23 is the vector sequence, 24-44 is the gene sequence) and 5' CTGACGTAGGGGCGATAGAGCTCGTGACGATTTGATCAGCGGAA 3' (1-23...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein PALS1 related to the plant height, the tiller number and the leaf shape of rice and an encoding gene and application of protein PALS1. The invention provides a protein which consists of amino acid sequences as shown in SEQIDNO:3, or a protein which consists of amino acid sequences which are substituted, deleted and / or inserted by one or more amino acid residues, as shown in SEQIDNO:3, and is related to the plant type and the leaf shape of rice and derived from SEQIDNO:3. The experiment shows that a PALS1 gene is separated and cloned from nipponbare, and the gene belongs to the CHR4 / MI-2-LIKE gene family. A transgenetic seedling obtained when rice is transformed by using an interference gene expressed carrier shows that the plant height, the tiller number, the leaf width and the leaf length of rice can be remarkably affected by the expression amount of PALS1, and the gene has certain application potential in plant type and leaf shape molecular breeding of rice.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering and biotechnology, in particular to a pleiotropic gene located on the long arm of rice chromosome 7 to control rice plant type and leaf shape PALS1 ( Plant Architecture and Leaf Shape 1 ) cloning and application. Background technique [0002] Rice is one of the most important food crops in the world and plays an irreplaceable role in solving the food security of all mankind. In the past sixty years, due to the green revolution and the utilization of heterosis, rice yield has achieved two great leaps. However, as the world's population continues to increase, food security remains a top priority for governments around the world. Therefore, it is particularly urgent to cultivate improved varieties and continue to increase yield per unit area, and ideal plant type breeding is considered to be an important strategy to promote the third leap in rice yield. The ideal plant type is an organic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/84C12N1/21C12N5/10A01H5/00
CPCC07K14/415C12N15/8205C12N15/8261
Inventor 马小定韩龙植马建曹桂兰雷财林张欣
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com