Supercharge Your Innovation With Domain-Expert AI Agents!

Cat long-acting fusion interferon as well as preparation method and application thereof

A technology of interferon and fusion protein, applied in biochemical equipment and methods, chemical instruments and methods, microorganism-based methods, etc., can solve complex problems and achieve the effects of reducing product cost, simple protein purification process, and prolonging half-life

Active Publication Date: 2015-01-28
CHANGCHUN SR BIOLOGICAL TECH
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the use of fusion proteins of INFα and HSA is extremely complicated. How to design the structure of the fusion protein so that both can maintain relatively independent biological activities; how to construct a high-expression strain and separate and prepare a high-purity fusion protein. Fusion protein structure and biological function identification need to be fully studied
At present, there is no method of prolonging the half-life of interferon by fusion protein in the application of interferon in dogs and cats

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cat long-acting fusion interferon as well as preparation method and application thereof
  • Cat long-acting fusion interferon as well as preparation method and application thereof
  • Cat long-acting fusion interferon as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] The preparation of embodiment 1 dog, cat long-acting fusion interferon

[0028] The recombinant canine and cat serum albumin-interferon fusion protein expression vectors were constructed with CSA, FSA, cIFN and fIFN respectively.

[0029] Preparation steps of dog and cat serum albumin-interferon fusion protein:

[0030] 1. Referring to the open reading frame of the canine serum albumin (CSA) gene (NM_001003026.1), the feline serum albumin (FSA) gene (NM_001009961.1) sequence and the physical map of the yeast expression vector pPIC3.5k, primers were designed and enzyme cutting sites were introduced Points, during which the natural signal peptide of serum albumin was retained, the stop codon of serum albumin was removed, and the signal peptide and start codon of interferon were removed.

[0031] (1) CSA upstream primer:

[0032] CSA1:

[0033] 5`-GC GAATTC GCCATGAAGTGGGTAACTTTTATTTCCCTC TTCTTTC-3', the 5' end contains an EcoR Ⅰ restriction site;

[0034] CSA downstr...

Embodiment 2

[0080] The activity detection of embodiment 2 dog, cat long-acting fusion interferon

[0081] 1. Detection of biological activity in vitro: WISH-VSV micro cytopathic inhibition method was used to detect the biological activity of long-acting fusion interferon in dogs and cats in vitro, and the cells were counted as 2.5×105~3.5×105 cells / ml of WISH cell suspension Seed in 96-well cell plate, 100 μl per well, 37°C, 5% CO 2 Cultivate under conditions for 4-6 hours. Prepare complete culture medium: 10% bovine serum MEM, assay medium: 7% bovine serum MEM, challenge culture medium: 3% bovine serum MEM. Dilute the standard sample to 103IU / ml with the measurement culture medium, then dilute the standard sample dilution and the induction culture supernatant to be tested 4 times, and dilute to 412 times. Add the doubly diluted positive control standard and the induced culture supernatant to be tested into the 96-well plate that has been plated with WISH cells according to the correspo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fusion protein formed by a cat serum albumin and an interferon. An amino acid sequence is shown in SEQ ID No 2. A cat long-acting fusion interferon is capable of prolonging half-life of the interferon, improving biological activity of the interferon in an animal body and lowering cost of an interferon medical preparation and is applied to controlling work of diseases of animals such as cats.

Description

technical field [0001] The invention relates to the technical field of prevention and treatment of animal diseases, in particular to feline long-acting fusion interferon and its preparation method and application. Background technique [0002] Interferon (Interferon, IFN) is an important class of cytokines, which are secreted glycoproteins produced by biological cells under the action of viruses or other heterologous substance inducers. It has a variety of biological effects, and has good therapeutic effects on viral diseases, bacterial diseases, tumors and other diseases. However, interferon has a short half-life in clinical application and is prone to degradation in the body. These problems limit the full play of interferon's biological effects and directly affect the effective application of interferon in clinical practice. Therefore, how to prolong the half-life of interferon and improve The effect of the biological activity of the hormone has become the focus of resear...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/81C12N1/19A61K38/21A61K47/48A61P35/00A61P31/12C12R1/84
Inventor 夏振强郑文文夏晓红金宏丽王照黄靖陈宪平付玉
Owner CHANGCHUN SR BIOLOGICAL TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More