Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene silencing technology based gypsy moth chitinase gene and dsRNA

A technology of chitinase and gypsy moth, applied in DNA/RNA fragments, genetic engineering, DNA preparation, etc., can solve environmental pollution and other problems, achieve the effects of reducing production costs, reducing mass use, and rational design

Active Publication Date: 2015-01-21
TAIYUAN UNIV OF TECH
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In our country, the continuous single long-term use of chemical agents has caused insects to have different degrees of resistance to various pesticides. Environmental pollution, forming a vicious circle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene silencing technology based gypsy moth chitinase gene and dsRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] The method for obtaining the full length of the chitinase 5 gene of the gypsy moth is as follows:

[0016] (1) Design of PCR primers

[0017] According to the known amino acid conservation sequence of insect chitinase 5, the following degenerate primers were designed as follows:

[0018] Upstream primer: CHT5F 5'-GAYTGGGAGTACCCHGG-3',

[0019] Downstream primer: CHT5R 5'-TCCATRTCRATRGCCCA-3';

[0020] (2) Design of RACE primers for chitinase 5 gene of Gypsy moth

[0021] Primers were designed based on the fragments obtained above as follows:

[0022] 5'RACE upstream primer: 5'- CGCTACGTAACGGCATGACAGTG(C) 16 -3'

[0023] 5' RACE downstream primer: 5'- GGTGTACGGAGCAGGATCGCCACC-3'

[0024] 3' RACE upstream primer: 5'- GCTGGATGCTATCCACGTGATGTCG-3'

[0025] 3'RACE downstream primer: 5'- CGCTACGTAACGGCATGACAGTG(T) 18 -3'

[0026] All primers were synthesized by Shanghai Yingwei Jieji Biological Co., Ltd.

[0027] (3) Obtaining total RNA of Gypsy moth

[0028] The 4...

Embodiment 2

[0037] The method for obtaining the lethal fragment of the gypsy moth chitinase 5 gene is as follows:

[0038] According to the nucleotide sequence of the gypsy moth chitinase 5 gene obtained in Example 1, specific primers were designed using primerpremier5.0 software, the upstream primer sequence is SEQ ID NO: 3, and the downstream primer sequence is SEQ ID NO: 4 , all primers were synthesized by Shanghai Yingwei Jieji Biological Co., Ltd.; among them, the upstream primer and downstream primer need to be designed for the nucleotide sequence of the gypsy moth chitinase 5 gene obtained in Example 1. After the design of upstream and downstream primers and careful screening of multiple gene fragments, the lethal gene fragment with practical application effect was finally determined.

[0039] The recombinant pEASY-T1 plasmid successfully ligated with the gypsy moth chitinase 5 gene obtained in Example 1 was used as a template, and the lethal fragment of the gypsy moth chitinase 5 ...

Embodiment 3

[0042] Obtaining the dsRNA of the Lethal Fragment of Chitinase 5 Gene of Gypsy Moth

[0043] The chitinase 5 gene lethal fragment obtained in Example 2 was used to synthesize dsRNA by in vitro transcription according to the instructions of the T7RiboMAX Express RNAi System (Promega) kit. The obtained dsRNA was detected by 1.5% agarose gel electrophoresis, its concentration was detected by a microplate reader (Thermo Scientific Multiskan GO, Thermo Fisher Scientific, USA), and concentrated to a final concentration of 1 μg / μl and stored at -80°C spare.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene segment of an insect chitinase 5 gene and application of dsRNA thereof. Through cloning and sequencing of the gypsy moth chitinase 5 gene, a full-length chitinase 5 gene with a nucleotide sequence as SEQIDNO:1 can be obtained, and a chitinase 5 gene segment with a sequence as SEQIDNO:2 is selected therefrom to be applied in dsRNA synthesis. After injection of the dsRNA into the body cavity of gypsy moth, gypsy moth dies due to ecdysis difficulty. Thus, the invention provides a new approach for development of safe and nuisanceless pest control methods.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to Chitinase5, a lethal gene fragment of gypsy moth based on gene silencing technology, and its dsRNA and the application of dsRNA in lethal pests. Background technique [0002] In our country, the continuous single long-term use of chemical agents has caused insects to have different degrees of resistance to various pesticides. Environmental pollution forms a vicious circle. In addition, gypsy moths can also affect human health. When people come into direct contact with gypsy moths, redness, swelling and itching often occur, and even rashes occur in severe cases. Therefore, in the practice of agricultural production, there is an urgent need for alternative control methods other than chemical pesticides. [0003] RNA interference (RNA interference, RNAi) is a gene silencing phenomenon mediated by double-stranded RNA. The double-stranded RNA is finally processed into a small RNA (siRNA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N15/10C12N15/113A01N57/16A01P7/04
Inventor 范晓军张建栋赵秋勇张常刘建红糜艳霞
Owner TAIYUAN UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com