Phomopsis RNA (ribonucleic acid) polymerase (RPB1) gene amplification primer, as well as design method and application thereof
A technology of RNA polymerase and Phomopsis, which is applied in the field of Phomopsis RNA polymerase gene amplification primers and its design, which can solve the problem of single-copy evolution rate and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0023] Login to GenBank to search for 60 Phomopsis RPB1 genes whose complete mitochondrial DNA sequences have been determined so far, remove incomplete and partial sequences, find conserved sequences, design amplified sequences, and add sequencing sequences at the 5' end to obtain a The general primers for Phomopsis fungus RPB1 gene: its upstream primer PhR1-F has 43 bases: CGCCAGGGTTTTTCCCAGTCACGACTGCAGCAAGGTGTTGGCTG, and the downstream primer PhR1-R has 43 bases: AGCGGATAACAATTTCACACAGGAGCGATGTCGTTGTCCATGTA. The size of the amplified fragment is about 750bp.
[0024] The general primer PCR reaction system and reaction conditions for amplifying the Phomopsis fungus RPB1 gene are as follows:
[0025] The PCR reaction system is 25μL, containing 2× Taq MasterMix, 10μM primer PhR1-F and primer PhR1-R, 50-150ng DNA template solution, and ddH2O.
[0026] 2× Taq MasterMix 12.5μL
[0027] PhR1-F 1 μL
[0028] PhR1-R 1 μL
[0029] Template 1μL
[0030] ddH2O 9.5 μL
[0031] The ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com