Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Phomopsis RNA (ribonucleic acid) polymerase (RPB1) gene amplification primer, as well as design method and application thereof

A technology of RNA polymerase and Phomopsis, which is applied in the field of Phomopsis RNA polymerase gene amplification primers and its design, which can solve the problem of single-copy evolution rate and so on

Inactive Publication Date: 2014-12-10
ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

RPB1 (the largest RNA polymerase subunit) gene is responsible for encoding the large subunit of RNA polymerase II, which has the characteristics of single copy and slow evolution rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phomopsis RNA (ribonucleic acid) polymerase (RPB1) gene amplification primer, as well as design method and application thereof
  • Phomopsis RNA (ribonucleic acid) polymerase (RPB1) gene amplification primer, as well as design method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] Login to GenBank to search for 60 Phomopsis RPB1 genes whose complete mitochondrial DNA sequences have been determined so far, remove incomplete and partial sequences, find conserved sequences, design amplified sequences, and add sequencing sequences at the 5' end to obtain a The general primers for Phomopsis fungus RPB1 gene: its upstream primer PhR1-F has 43 bases: CGCCAGGGTTTTTCCCAGTCACGACTGCAGCAAGGTGTTGGCTG, and the downstream primer PhR1-R has 43 bases: AGCGGATAACAATTTCACACAGGAGCGATGTCGTTGTCCATGTA. The size of the amplified fragment is about 750bp.

[0024] The general primer PCR reaction system and reaction conditions for amplifying the Phomopsis fungus RPB1 gene are as follows:

[0025] The PCR reaction system is 25μL, containing 2× Taq MasterMix, 10μM primer PhR1-F and primer PhR1-R, 50-150ng DNA template solution, and ddH2O.

[0026] 2× Taq MasterMix 12.5μL

[0027] PhR1-F 1 μL

[0028] PhR1-R 1 μL

[0029] Template 1μL

[0030] ddH2O 9.5 μL

[0031] The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a phomopsis RNA polymerase (RPB1) gene amplification primer, as well as a design method and application thereof. The primer is designed to aim at a universal primer of phomopsis funguses. An upstream primer PhR1-F has 43 basic groups: CGCCAGGGTTTTCCCAGTCACGACTGCAGCAAGGTGTTGGCTG, and a downstream primer PhR1-R has 43 basic groups: AGCGGATAACAATTTCACACAGGAGCGATGTCGTTGTCCATGTA. The primer can rapidly perform large-scaled genetic background analysis on the phomopsis funguses, and provides an important tool for species identification, geographical population identification or inspection and quarantine works of phomopsis in the country of China.

Description

technical field [0001] The invention relates to the technical field of identification of Phomopsis fungus, in particular to a Phomopsis RNA polymerase (RPB1) gene amplification primer and a design method and application thereof. Background technique [0002] Phomopsis (Sacc.) Bubak is an important fungal genus in Deuteromycotina, Coelomycetes, Sphaeropsidales, Sphaeropsidaceae , which has a sex state of the genus Diaporthe, which contains more than 400 different species and is distributed worldwide, mainly concentrated in tropical and subtropical regions. Phomopsis is an important pathogenic fungus in agriculture and forestry. It hosts 74 families of plants and can cause a variety of plant diseases, such as ulcers, stem rot, fruit rot, leaf withering, branch withering, root rot, bark necrosis, etc. . In addition, some species of this genus are also important endophytes and saprophytes of plants, and can even harm humans or other mammals, occupying an important position in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/645
CPCC12Q1/6895C12Q1/6806
Inventor 胡佳续郭京泽刘鹏王金成罗加凤廖芳黄国明
Owner ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com